Description :
From Genome Similarity Track
Location :
Scaffold_62:146647- 149184
Transcript NameFunction/comments
Sapdi_VS20SDRG_13664hypothetical protein
Sapdi_VS20SDRG_13665hypothetical protein

Sequence
2537 bases(100 bases per row)
ACGCGGCAATGGTGGCGTCGACGCAGGAGCGAGAAGCCTTTGCCGCAGCCTGTGCACTGCGTCCGCGCTCGGTCGGGCACCCACATAGCCCGGGCGCACG
CGCTGCGGATCTGCGTACCCCGCCCGATGAACGACGACGTTGACGATGCAGTCTCCATGCTGAGACGACGGTTGATTGCTCTTGGTGTTTTTGAAAAATG
ACCCGCAAGCACGTATCCGGACAGGACGGGCCAATCAGCGCCGCGGGGCCGGCAAGGGTGCGTGCGCTTGTGCCACGCTTGGGTCGGAGACGCGCAGCGC
GCCTATGGACGGGCGACCTATCTTCTGATTCCGTGCTATTGGCAGTACAGCCGCTGTTAGATCATGCAGATATGTATGTATTCGTAGCAGCGTACGCGGA
CGGCCATGGCGCAGGCGGCATGCTTTCTCGGACACCGCCGATGCGGCATTGGCCGCTCGTAGCGCACTGTCGAGGGTGTGCGCCAGCTGGTTCTCGACGC
GTATTTGATGTTGCAGCTTGCGTTGAAGACTCAAGGAATCATCGCGCGGCGCTTTTGCGAGGACCGGCCCGACGGCTTCGCAAGGTGCGATCCGTGGTGA
ACCAAAGGAGCCGAGGACCTTGCGTTTCGGGGCCAGGTCGGCCGCCGTGGGCGGTGCGCGCGGACCTCGAACAGCGGCGCTCTTTGGTGGTGAGGGCGCG
CGTGGAAGGGCGCGTTGCAGCAAGAAACGCGGTAAAGCGAGCCGGTTGTTGCGGAGCGTCGTAATTGGTACGCACTGCAGGAGCGGTAAAGTGCTCGCAG
TCACTGGTTTCGGGTGCGAGCTCGTCGCCAGCTGTGTCGCGGTCTACCGACATACGCCATTGCAGTAGCCATTCGACTTCAACCCACAGAGTAGAAACAA
GCAGAGTGACCTCTTCGCGATGCGCGTGCCACTCGAGCTGGGCGCGCCACACCTTGCGCAGTGCACCCAGGCCGCGTTTGCCCAAGATTCGTTGCAACTA
CACAAAGCGCTATGTCTCGTCATCGCACGAGGAAGGATACGCGTACCATGAAGGGCGCGCCGGGGTAATGCAATACGAGGAGCGACACGTCGCGACTGGA
TGCCACGAGCTCCAGCGTGTGCCACGAATCGTCTTCACAGAGCGCAACGTTCCCGCGGCTCAACGTGGCGACGTGTGCGTCCAAGCGCAGCGTAGGCTCC
CGCCACCTGCGCGCGTCGTTGAGTTGATTGGTCGCTAGAAAAGCCAAAAAGCATCCTACGACTTTTCGTGGATGGCTCGGCGCAATGCGAGCTGACGTTG
CACGATGCACTCGCCGTCTTGAATCAGAACGAGCGCGTCTGAAGCTTTCGGCAAGGGCAAAATCACTACATACAGCATGGCGGTCAACGTCTCCATGCAT
CTGAGTCTGTGCAATGCAAACACGCAGTCTACCGTCCATGCGGCGACAGGCGCGGGGCGTGAGACCGTACCAGAGCGAACACGCGCGATCGCGGTCGAGG
GCTCTGAGCGCGTCCGTCTACAAACACGCAACCCACGTCGTTGAAGTTGCCGCGATCGGGTGACGCATTACATGCTGAAGAAAGGCCAGGCGGTCTTGCT
GCTCCACAACACCCGGCCACGACTGGAGATACTCGACCTTATTGATAGCAACGACACGCGCACCGTGAGTCGCAATGGCCGAAATTTGCCGGTGGTTCTC
AGCGGCCAGCACCTCGTACTCGCCAAAGACGTCGCCGTTGTTGACTGTGCGCACACGAACGTAGCCCGTGAGCTCGGCAGCATCGGAGGTCGAGGTGAGT
GGCGTCGATGTCGATAGATCGATCGTGGTACCAGCTGTCTGCACCAAGTCGACGGACCCTGACACGAGCACGAAGACGCGCTCTGTAGACGCCCCCTTTG
TAAATACTAGACGCACTTCAACACGTCTGTAGACTGCACGCACGAACCGTACCGTAAGCATTGGGCGCAAATGTCTGAAACAGCGTGCGCTCGCAAATCT
GCTCTCGGAGGGCCGTCGCCATTTTGACAAAACAGGGCACGTCCACGACAATGTCAAGCACGAGCTGAATGCGCTTCTGGCGCGCAAAGGCAATAACGCT
CGGCCACTGCGAGCGCTGCGCCCGCTTCTTGAGTACAAAATGAACTACAAGCTTCCACAGATCCCGCGCGCGCCTACGTGACGTGACTTGTGCTCCTCAG
CCGTCAAGCAGGCCAAGGTACTGGGAGCCCTGGTGGGATGGACGGGGTGCAGGACGGCCAAACGCAACTAGATTCTCATATGCATCGCGATGCAAAACAA
GCATCGCCGCGGCCGTCGTCGTCACCTGCAGCAGAGTAGGGTTCACACAAGGATATGCGATTGGACGCACGATAGTCGATGGGTGGAGAAGGCCTCCATC
AAAGAGAGCGCGCTCGCAGATGACGTCGCCCGGACCCAAGGTGGCTTCGCGAACGCCTCGACGGTCGCCGTTGACAGCCACCGGGACGGGGGATTGCAAA
AGCTTTTTTATGCTACGGGTGCTTTTACGGAAGAGGG