Description :
From Genome Similarity Track
Location :
Scaffold_87:14657- 27201
Transcript NameFunction/comments
Phyag_g1826mannosyl-oligosaccharide alpha-1,2-mannosidase, putative
Phyag_g1827hypothetical protein PHYSODRAFT_557349
Phyag_g1828hypothetical protein

Sequence
12544 bases(100 bases per row)
CATGTAatacgacgacaacaacccTCCCATCAGGCGGATCGTCGTCTCAAAGAAGCTGATGAATCCACTGAGGAAGATCCTTTGCTCCATATTGTTGGCC
ACCCATTCACTGGCACGGTCAAACTCGTCAAACATCCCCACAAGATACAGAGTGTCCAGTGCATTCACTAGCGTCAGTGCCATGTCGTGATCTGGCAGTC
CTGTTCCCTTGTACGTCTTGACATTGAGGGAATCGTGTCCATAGGCGTAAGTGGAGTAGCCCTTCCAGGCCCATTGCACCATGTCCACCACCTGCTTCTG
GTCCTCATTATGCAGCGACGGGTCGTAGggcgctcgtcgtcgctgctcctcctcgtgcgTGGGGTCGCTGGCCGGGGGTTCGAACTCGAACGtgtcagct
gcagctgctgcaggctcaGGGGCTTCTGTGCGTTCGATACGTCGCAAGTGGTTCATCCATCCGTTGTCCACTTGGCTTTTGGCTTTATTGCGCTGTGGAg
agacgacgctggagctccagAACACCCACTGCGCGACGATGCCGACGCATAGAATCCCTAGCAGTAGACGCAGCACTACTGCAGTGGACAGAGAACGGGA
GGAAGAGacgctgcgactgctgctgctgcttcctcgactgaagctcttggtgggcagtggaggagacgaTAAGGAGCTCAGCGGCGGCTCGCGGATGTTG
CTGAGGCGACGAGCGCGCGGCTCCATACTGACGAGGGGATAATCGTAATTTGAGCTTATAACTTGGAGTCAGATTGGGCACGGGTTTTAACCAATGAGGA
CAGAGTACCAACAGCAAAATAATATTTTTGTCAAGAAAATATTATTTTTCTGCATTTTGTATTTAggcccaagaagagcaatGGATGGGATGGGTGTTGG
GGCAGATGACGAGGAACAACTTGTTTTATGCGTGTCAATTGAGAGCGTGCTGGGTCTGCTGGTTGGACGAGGAGATAGAGGgggttcttctccagcggTC
CCCTTGTCTGGCGTGGTGGACTCGACGGGTTCATTGAGAAAACGACGAGTGTCCGATTCGGGTCTAGCGACCGGGATCCCGATGCCCCGTGCATATAACC
GAGTAGGTTTTACGTCGATCAGGAGTGTTTTAGGACGAGAATGAAGAAGCACAGGGTGATGAGACTCAGCAGtaagaagatgcagcgctCGGGTCTCGTG
TTGCGCTGGTATTTCTCGGCCCGTTCCAGTTGGCCCAGTCCCGAACGCATCCTCTCCACTACCTGACAGTTGCAAAGATACAGAGAAGTAGTAGTTCGTT
TGGTGTACACGTGTAGAGAGTTATTGGTTGGGTTTACCTGCTCCATGTTGTAGTCGATCCGGTCGATGAGCGTTCCTTGGTCGATCACCATCTCGGCTAC
TTCTTTGAACATGGTGGCCAGTGTTGCGACGGACTTGGCGATGCGTTGGATCTCAAGGTCGCGCGTCTTGATGTCGTACTCGGTGTGGTCCATTGCCATG
TAGGTGGATTTGTTGCCGAAGCGGAAGCTCTCGCCTGAATTCCCAACGCCCCTTTCCATCgcctcgacgtcgaagaTCTCGCTCCCGAACttttgaagct
gaagacgctgaagaTACTCGCGCTGTCGTGTTCGAAACTGGATGGATATCTTTTGCAGTCGACTGGCAATGGCGCGCTGCGTGTTCAATCGCACAAGACG
GTCTGCTGGTGACGGACTGGGCTCACCACCGACGAAAGCGctcgtgatcttcttcagtgaGCGATCGGCTTTGTGGAATAACGCTGTGATCTCCTCAGTG
AGGCAGTTGATCTCGTGCTCTTGCTCCACCTCCGAGTCATCGAAGCGAATCATCAGCCGTCGCGtatgcagaagctgcaagtATTCCACTGCGATCAACA
CGGACAAAACGTCAATCAAACGCTGCAACAAACCCAAGCCTTTACAAGCACCAGCATCCGCGTACATTTCGCATGAAGCAAGCGGATGGATTCGTCTGCG
CTGTCGGCGAAGCGTGTCCACTCTGGCTTGTGAATATCGCGATGGTCTCCTCCTGGGAACTCGTTtgcatcttgcagcagtgccttctccatcgcgaTCG
ACTTGTTTCTCTACATGCCAACATCCCATGTTAGAAtccgacgtgctgctgcatcagcttgGACGATCTCGGCACCTGTTTCGAGAGGAAGAGTGCAccc
agcagcggcgacttgTCCAGCCGCGGACGCATCTGGAAGCGCAGGTTGCGCTTGCGCAGGTTCGCTCTCCGCTCCAGGAAGCGGCCCGTAAGATCGCGAT
ACGCCATGTTCACCAGGTTTGACCACCAGATAATACAAGATCGGACGATCGAAACGTCGCGGATCTTCATTTCCATTGGTCGAAACcccgtcaacttcaa
cttacgAAGGTGTCCATTGGTAATCGGCGCACTACACTCGACAAGGACGCGATGGCCGCGGAGACGGACGCTGTGGGCGCTACGTCGCCAATTCTACGCT
GGAGTAAGTTGGAGACGACAGCCAGACGCAATGGCGAAGAGCCGGCACGACGTTCGGGCCACTCGCTGTCCATCGTGGGCTCTAGCGGCTACTTGTTCGG
CGGCTGCGACTATGCAGAGCCTCCAGGCCCCACCAACGACCTGTTCGCACTTAAGATCAACGCCAACGCTCCAAGTGAATGGGAGCGACTGCAGTCGCCA
TTAAGCGGCGCGTGGCCCCCTCCGAGATGGAAACATTCGGCGACAGTTGTGGACAATAAAATCTACGTCTTCGGCGGCTTCCACAGCAGTTCGACAAGGT
TCAACGACCTGTGGATCTTCAATCCCATCACTTTGGACTGGAGTCAGTCTGGATCGACACCTCTCAATAGTAATAGCCCCTTACATCGTGCCAGTGTGGC
GAAACCTGTAGCGCAGACACTCCCAGCACCAAGAGGAGCCCACTCGGCAGTGGCTATTCGACGCTCCATCTACGTGTTTGGAGGTTACGGAGGCACCGGA
TACGGAAGAAGAGACTTTGACGACTTGTATATGCTACGCACAGATGATCTGAGCTGGACCAAGGTTACGTGCAAGGGGAAACCACCAGAGAAACGAGCAG
GTCATCAAGCCTGTGCGGTAGATGATCTGATGCTGGTGTGTGGCGGGTGGAACAGCATGGCGCAGTTTAATGATCTACATATTTTTGACTCGACGGTGAA
CTCGTGGACTCTTGTGGAAGGCACGCATatggccacgacgctgccgagATGGAACCACGCGTGCTGTGCAGTGCTGGCCATTCCACATGCAAAGGTTTTC
GTGTTTGGTGGGGTCGTTGGAGAAGACAACAACTACAATGCACAGGGAAATTACATGAACGATTTAAGTGTCCTTGACACGGGTGAAATGAGCTGGAGTA
TTCCGGAAATCGAAGGCTCTCCACCCTGCGGGCGAAGCGATACAACGCTAACTTATGACGATAAAGGAAGTCGCCTCATTGTTTTTGGAGGCTGGGCAAA
TGTATGGCTCAACGATATTTTCTACCTAGACGTGAGCTGCGTGGTGGGACCTCCGTATGGAATAACGGGGATCTTCCCAGACTTTGGACCGATCACTGGT
GGCACGCAGTTGGTGATCGAAGGCATCGATTTTGTCAATAAGCCAGTGGCTATTAGATTTTCGTGTCGAAAGGGGGCTGTGGATGTTCCAGGTGAATACG
TCAACGATCACACTTTGAATGCTGTAGCACCAGACTTCACTGCGTACCCAGCTGGAGATGTTCAGGTCCGTGTGGCTTTGCAGGGCGATTCATTCACAAC
AACGTTCCAGACGTACAACTACTTCTCCGTGAGTGATGCGCCTCTATGTTTTGCGTATGGACCCGGAGTGCTATCAGGTGGAGCTAGTGGTGAGCCGACA
TGCTTCGTTATTCAAGCGAGAGATGCTCAGCACAATGTGCGTACACGTGGTGGGGACGAATTTGTGGTTGAAATCTGGCTCGATGAATCGGGCCCAATGT
TCCTGCCGAGCTTACAGATCCAGGATCTTCTCGATGGGAAATACTTAGTAAGTTACGCGGTTCCAAGTCCTGGAGAGTATCAAGTCAAAATTGAGTTCCA
AGGAACATTTGGCGGTAACGCGGGACCTATCCGTGGATCTCCATACATGGCTACCTTTGACGATACCGTCACTCGAGAGATGAATTTGATGACTGGAAAA
CTCGTGGTGGATCAAGTATTGCACGATTTACAAGGACTCCAACAATCGACACGAGAGTGCAATATCGGCCTTGAACAACCAATATCCGATCCTACTTGGA
CACCCGAACAAGTCACATCTGCATTGATTAAGCTGAAAGAGCACGTTTTTATGGTGGAGAAGCGGGGTGAAGGAATTTCTTTATCGATTGAAGAACTCCG
AGCCGAGATCGCTTTTCTTAAAGATGCAGGCATCATGGtcaccaaggagctggatATATTGATGGCGATCGAAATTGCTTGGAGTGAGGTGTTGAGAAAA
GTTCCTGCTGCAAGCAATCGCATTGCACCGTTGATCTCGACTCAAAGCCTAAAGTTCCGAGAAGAGGTTGCTGCCTacgtggaagagctgcaagccAAAG
AAGCGCAGCTGAAAGCAAAGGGTTTCTGGAACTTTTCTGTTGGTGTCAATGTTGCTATTACACTAATagcagaggagaaggaacATACTGAAAAGGACAC
AGAGATTTTCAAACAAAAGAAGCACGTCGCGGAGATATTGGAGTGCGAAGATTTAATGGAACCATGCACTGCCATTTTGACAGGAATTCAGCGGACACTT
ACACAGTGCCATCAAATGTGGGAAGCAATTTCAGAGGTTACGAGGAAAATTGATCTATCGAGAGATATTCCGTGGAACATGATCGACGGTATTGTATTGG
aagaggaggccaaggcgtTTTTAGCGCTTGTAAAAGCCACGCATAAGGATATTCGGGACTGTGACGCATTCAAGAAGTTTGAGCGACTCGTAAAAGATTT
CCTCAGCACCTGTCCGCTGTTTCAAGCTCTGCGGCATCCGTCTATGCGAAGACGCCATTGGCAAGACCTCATCGCAGTCTCAGGAAAAACATTTGACTGT
CCCGACGATAACCCATCCATAAAGTTCGCTGACATTTTAGCACTAAACCTGCATGAATTCCAGCGCGATGTAGAAGAAATTACGGATCGAgcgcagaagg
aggcgaagcAAGAATCAGTTCTACATGAACTTGAACAGCGTTGGTCCAGCATTTGCTTGACGATGACACCGTATAAGGAAACGTCGGTGCCACTACTCAA
TATGGCAGAGGATGATGTAGAGATGCTGGAGTCCGACCAGTTGCTCGTGCAAGGAATGGCGTCAGGACGAAATAGTTTCTTTCAGGATCAGACGCAACAA
TGGCGGTCTAAACTCATGCTTGTTTCTGAAACAGTTGGAGCTCTTCTCGATATTCAGCGTTCATGGTCATACTTGGAACCGCTCTTCATGCAGTCGGAGG
AGGTCAAACGGGAGCTTCCTGATGTGGCTGCAAAATTTGAagatgtggacgagatcgtaCGAcaaacactgcagcagatgtGGGATCAGGAGCCACCGGG
GAATGTGCTCCATGCTTGTCAGCTCCCAGGTTTACTCGATCTGCTAAACGATCTCCGCGCACGACTGGAAAAGTGCCAACAAGCTCTAAAAGAATATCTC
GACTCAAAGCGCCGCCTATTCCCCCGCTTTTACTTTATTTCCGAAGCCGACTTGCTTGACGTGCTGTCAAATGGTAGCAGCCCACAGAAGATTATGGTTC
ATCTTGAGAAGGTGTTTCTGGCCACACAGACACTGCTCCTCGAGAAGGTAAACAATGGAGCTGCCAACGGGATGCTAGCTACCCACTTCATATCCAACGA
CTCTGCAAAAGAGAATATTGCGTTCGAGAACAAGGTTCACTTGGAAGGAAAAGTAGAGCTCTACATGCAGACGATACTGGAGTCGATGCAGCTCACGTTA
AAGGGTCATGTCACACGCTCCATCAACCGATTTCCTGAGCAAAATCGTGTAGATTGGCTACTACAGAAAATTTCACCAGCTAATGAAGGCGCAGTTTCCA
AAGACAACGTGGATGCAGCCCAGATTGCACTGCTTGTTGCGGGTATTGAATACGCAAGGAGCGTAGAGCATGCTTTTGAACTGATCTTAAAAGGACATGC
GACCGCCATGAAGGAGCTTCTTGAGAAAGTTGTGATTCAGCTCAACGATCTGATCAAGCTGACCCAGACGAACTTACCTAGAGGTGATCGACAGCGTACT
ATGTGCATGATCACCATGGATGCGCATTCTCGAGATATTGTGCAAAAGCTTCTTTATGAAGAGATCACCACGCCGAGTTCCTTCCTTTGGCAGTCCCAGT
TGAAGCAACGACGGTCTGATCTTCGGAACCACACCTATCTGGAGATCTGCGACGCAACATTTGACTATGGATTTGAATACTTGGGCAATGGTCCGAGGCT
CGTGATCACACCCCTGACAGACAGAATTTATGTTACTGCTACCCAAGCTCTTCACATTCAAATGGGTTGTGCTCCtgctggacctgctggaaCGGGCAAG
ACAGAAACAACCAAAGATCTAGCAAACATGGTGGGCAAAATATGCTATGTCTTCAACTGTTCACCAGAAATGGACTACAAGAACCTGGGAAACATTTTTA
AGGGATTAGCGAGTGCAGGGGCATGGGGGTGTTTTGATGAGTTCAACCGACTTGCTCCAGAAGTGCTATCGGTATGCTCAGTCCAATTCAAAGCTGTCTG
CGATGGAATTCGAAGCGAAAGTAATCATGTTGTGGTGGAGGGTGACTCGGTCAAACTCGATCCAACGTGTGGAACCTTTATCACAATGAATCCCGGGTAT
CTCGGGCGATCCGAACTACCCGAAGGCTTAAAGGCTTTATTCCGACCCATTACCGTGATGGCGCCAGATCTTGTGCTTATCTGTGAGAATATGCTAATGG
CGGAGGGATTCCGAGAGGCTAAGTTATTGGCGGCTAAATTCTTCAGTATGTATTCGTTACTGCGGGAGCTACTTTCTAAGCAAGATCACTATGACTGGGG
TCTAAGAGCCGTGAAGAGCgtacttgtcgtcgctggctcGTTCAAGCGAGCCGAGCCAAAACTTTCCGAGCAAGAAATTCTCATGCGATCACTTCGAGAT
TTTAACCTGCCCAAAATTGTGAAGCAAGACCTTCTCGTGTTTAACGGACTACTTAGCGATCTCTTCCCCAATCTTAACCTGCCGCGTAAAATCGACGAGG
TAATGGAGAAATACGTTCATGTTGCGTGCGAAGATCGCGGGCTTTGGCCTCACGAACAATTCCGATTAAAAGTCATCCAGCTTGAAGAACTGCTAGCCAT
TCGTCACTGTGTATTCGTGATGGGGCCACCAGGAAGTGGGAAGACGGAATGTTGTGAGAcccttgttgctgctagGAAGAAGAAAGGCGAGCAGCATGTG
ACTAAGGTGATTGATCTCAATCCTAAAGCAGTTTCTACTGAAGATCTATATGGGTATATGGTTCTCGGGTCACGAGAGTGGAAAGATGGTCTTTTGTCGA
AGATCATGCGCGACGTGGCTAGTGCCTCAGTCACTGATCCTCACCCGAAGTGGATTGTACTGGATGGAGATCTTGATGCTAATTGGATCGAGTCAATGAA
CTCTGTGATGGACGACAATAAAATGCTGACACTAGCATCAAATGAACGAATTCCACTAAAGCCGAACATGCGGCTACTTTTTGAAATTCGAGATCTGAAG
TACGCAACCCCTGCTACGGTGTCACGCGCTGGTATTCTCTATATATCTGATGATGATGGTTTTCAATGGAGGTCGTTCTTGGCGAGCTGGGTGGCAACTA
AAGGCACGTCCGTTCAGCAGCGCACTGTCTTGGGAGAGGCAATGAACAAGTACATCGACCCCATCATTTCGTTTGTCAAGCAGAGTTGCAAGACTATTGT
GCCAATGCAAGCGATCACCATGGTTCATACGTACCTCTACTTTCTAGACGCGGCGATCGACGCAGAAACACTGCGAGACGCCAAAAAAGTAGACATTCTC
AGTGGTTTTGTCTCCGTATGGGCATTTGGAGCCGCGCTGACGATCACTGATGATGGAACAGACTACCGCAAACTATTTAGCGAGTGGTGGCGAAGCGAAT
TCAAGCACATCAAGTTCCCAGCTCGTGATACTGTGTTTGACTATTGGCTTGACCCGAACACGCTTACCTTCGACACTTGGAGAGCATCGCCGTACTTTAA
AGCTGTCCATTTCGATGGGTCTGTTGCTATGTCATCAGTCACTGTGCCTACTCCCGAGACTGCCTCCATTACAAGTTGGATGAGCATTATGGTTCGTGAA
GAACGTCCTTTCATGCTCTGTGGCAATGCAGGCACGGGCAAAACTCAGCTTGTTCAGGGATTACTCAATAACCTAGACGTTCGAAGCTCTGGAGCTGTTT
CATCGCCGTccgttgctgccaccaaAGGACCAGCAGCTAGCATGAGTGTCAACTTTAACTACTACACAAACGCCAACGCGCTTCAAGCCATACTCGAGTC
AAAGCTATCGAAACGGGTCGGCTCGACATTCGGACCAACCGTCGGGGACCAGTTGATTTACTTCCTAGACGACCTGAATCTTCCCCAAGTCGACCCGTAT
GGAACGCAGAGCGCTATAGCATTGCTGCGCCAATACTTGGACTATGGCCACTGGTATGACCGAGCAAAGTTCTCGCTTAAACAGATCGTCAATGTGCAGT
TCCTGAGCTGTATGAACCCCAATGCAGGTAGTTTCAGTATCAATCCGAGACTTCAGCGGCATTTTGTAACGTTTGCTCTGCCTCAGCTCAGCGCAGCGAG
TTTGCAAGTTATCTACACAACTTTTCTCGAGGGTTACGTGGCTGATTTCGTTGAAGATATTCGCAAGATGTCCCAGCCTATTCTGAAAGCTGCGCTTAAT
CTCCATGTACAATTGTGCAGTACATTCCGCAAGACTGCTGCCAATTTCCATTACGAGTTTAATATTCGGCACGTGGCGAATGTTTTCCAGGGATTATTGA
TGGCGAAGCCTCCGACATTTGAAGACCCCCTCAAGTTTGCATTGCTGTGGGTTCACGAATCTTCTCGTGTGTATGGAGATCGCTTAGTTTCGACGCAAGA
CCAGGCGAAATTCATATCAATtgtacagcagcaagctcgaAAGTGTTTTCCAGCGCTCAACTTCACGCGTTACTTTGCCCCAGCTTCCTCTGGCACAGAA
AACGAGTCTTCCCTTCAAACCGATCCAGTACTATTTTGCCATTTTGCAAATGGCTTGCGCACCAACGAATACGACCAAGTTACGTCATTTCAAGCGCTGC
ATACTACTGTAGAGGAAGCGTTGGCAGAACACAATGAGCTGAACGCAAAGATGGATCTGGTGTTGTTCAAAAATGCACTTGAACATATTGCTCGTATCGT
GCGAATTATTTCAAACCCGTCGGGACATGCACTGCTGGTTGGTGTCGGTGGAAGTGGTCGTAAGTCACTGGCGCGGTTAAGTGCTTTTATCTGTGGGTAC
GCTCTGGTGGAGATCACAATCACTCAAGCGTATTCGCTTTTGGACTTTAAATCCGACCTCCAGAACATGTTCATGAAAGCGGGCGTCAAAGGCGAAGGTG
TAGTGttcctcttcgacgacaatcAGATAAAAAATGAGCGGATGCTTGTGTACTTGAACGACTTGCTGTCAAGTGGAAACATCCCAGATCTCTACAACGC
TGATGAACAAACGAATCTAAtccagcagttccagccGAAGATGATGGCAGCGCTAGCAGCAAACGCCTCTGTGGATCCGTCCGGCAATGCTGCTAGTAGT
CAGGGCTCTGAAGGATCCGAAAAAGAGCGTGCGTGGAGGTGGTTTGTACAAGAAATCAAGCGCAATCTTCACGTTGTACTCTGCTTTTCTCCTGCAACAT
CAGACTTTCGGATGCGAGCCCGGAAGTTCCCAGCACTAGTCAATTGTGCACTCATTGACTGGTTCCAGCCGTGGCCAAAAGAGGCATTACGCTCAGTTGC
AGCACGTTTCCTATCTTTCGATAATCTACCGCAGCTACAACCCCCAGAAATGGTTGCAATGGCCATCCAAAACTTCATGCCATTCGCTTTTCAGAGCACA
AATGCTTTGGCGAAAGAATTTTTTGCGCACGAAAAACGTCACGTGTACTCGACACCGAAATCGTATCTGGAATGTCTGACATTGTATCGGCGACTACTAG
CCCAGAAGCACACAAGTCATCAAAAGGCAATGCAACGGCTTCAAAGTGGATTGGAAAAAATGGAGTCAACAGGAGAAATCGTGGCAAccatggaggagga
gttAAAACACACcctcgaagaagctgaaaagaAGAAAGTCATCGTGGAAGAGTTAGCAGCACGACTGCAGAAAGACAAGAATCTTGTGGAAAATGAAACA
GCTAGAGCAAACGTTGAACGCGAAAAATGTGCGGTTATCCAAACTGATGTGTCGGCAAAGAAAGCAGACACCGAGGCAGACCTAGCACAAGCACAGCCAA
TGGTGGATgctgcgatggcagcgctAGACACTCTGAACAAAAAGGACCTTGGTAACTGCAAGACCATGGCAAAACCTCCTGCAGGTGTCGGTGACATATT
TGGTGCTGTGATCGTACTTTTCGCTGGCGTGAATCCAAACGTAGTAATCCAGAAAAATGGCAAAGTGAAAGACAAAGATCGATCATGGGAGGCCTCGAAG
AAGACTTTGCTGGGTAATATTAACGCGTTGGTGGAAGAACTGAAAGGGTTCAAGGCATTGGTGGACAGCCAACAAGTACCTGAAGTGAACTGGAAGGAAA
TTCGGCCGTTTTTACAACTTGAACATTTTACAGTGGAGGcaatcgagaagaagaactcaGCGGCTGCAGGGTTGTGTGCCTGGGTGATCAATATCGTGGC
GTATTATGACGCTATTATAGTGGTGGAGCCCAAAAAGCGAGCTTTAGAGGAGGCAAACGAAAAATTGCGGGTGGCTAACGAGCGACTTGAACTGGTGAAC
CAGAAGGTGACTGCACTGGAAGAGAAACTTGCAACGCTGACCGAAGAGTTTGACAAGATTAACCAGGAGGTCCTAGACGCAGTGGCGTTACTGGAGAGGG
GTCGGCTTCGTATGGAACTCGCTCGTCGGTTAGCGAATGCTCTGGGCAGCGAGAGTGAACGTTGGGCTCACGAACTTGAACAGCTCCGTGCAAGCGCTGA
GATGCTGGTCTGCGACGTCGTGATCGCTGCTAGTTTTGTTTCGTATGGTGGTGCTTTCACGAAGCCATTCCGGGATATGCTCATCAATGACAAGTGGATG
CCGTTCCTGCGTAAGTCTCTAACTGAAAAGCTATCTAAGGGCGAGAAGGATAAGGACAAGAGCGCTGCAAGCGCTATGACTGAAGATGGAAATCCCTTGC
AAATTCTTGCGACCCAGTCGGAAATTGCCGAATGGAACACTAGAGGACTTCCAAGTGATCGCGTATCGATTGAGAATGGTGCTATCGTGCGCAATAGCAC
TCGGGCACCACTGTTAATTGACCCACAGCTCCAAGGTATCTACTGGTTACGAGAAATGGAAAAGCATGCGCGGCGTACGGCACCAAGCTCGTTACAGGTA
GTGCGCCAAGACCAACCAAATTTGACTCTTTTATTGGAAACTGCAGTGGAGCAGGGTTATACTGTGATTGTCGAGAACATTGGCGAGAAGTTGGAAGTAT
GTTTGTGGCCCGTGATTTCTCGATCTACTACGGTTCGTGGGCACAAGACTTTTCTGAAAATGGGAGACAAACTTGTCGAGTTACATTCAGAATTCCGCTT
GTACTTACACACGAAATTGTCGAATCCGCACTATCCGCCTGAGCTGCAGGCCGAGACCACAATGATCAATTTTGCCGTGACTCAACAAGGCCTTGAGGAT
CAACTCTTGTCACTTGTAGTACGCAAAGAGTGGCCGAAGATCGCTAAAGTTCGTACAGCACTTATTCATCAGCAGAACGAATTCAAAATTCGGATACAGA
CGTTGGAGGATCGTATCTTGTCAAGCTTGGCAGACGCCGAAGGTGACGTGACGGAAAATGTGCAAGTTATCACGGATCTGGAAACAACCAAGGCTACTGC
GCAGGAAATTGCGAAAAAGGCTGCCAAGGCTACGGAGTATGAGGCGCAGATAAATGAGCTGAGTGCAAAGTATCAATCTGTAGCAAATCGCGGTGCACTA
CTATTCTTCATCATGGATGGACTGCATCGCATCCACTCGTACTACGTGTACTCTCTGAATGCGTACGTCGTGATTTTCCAGCGAGGTATCGACCTGGTGC
AACCTGAAAAAGAACCTGGGAAACCTCCGTCCGCAAGCAGCGGTGGCTTGCTTGGTCGGTTgaaggctgctgcaaagAAAGTGATCGTTTCGCAACGATT
TCAGTGGAATTCAGATTTGTTGCTTGCCGATCGCGTTGTGGAGA