Description :
From Genome Similarity Track
Location :
Scaffold_29:1465125- 1466163
Transcript NameFunction/comments
Phyin_T30-4PITG_13613P-type ATPase (P-ATPase) Superfamily

Sequence
1038 bases(100 bases per row)
GCAACAGTATGAACCATTGGGCTCATAACCTGTTAGACAGAGGTTATACTGTGAGAATGTAGAAGTGATATTTGCTCTGTTAACCATCTTCCTGTGGCAG
CCACCCGTGTCACCTCTCCTGTGCTTCCGTATAGTCGGCGGCTGAACCGGTCTTTTCTACCGCCTTGAGCCGCAGCTGCTCCAGCCGCACGGTCCAAATC
CAACAGCTGCAGAAGAACGTCCTTGCAACGTACGCGAGACGCGGGTACCGTAAGCTGTGTTTGGCCTATCGAGACAGTGAAATGACCGGCGAGGCTGTGG
ATTCTGCTTCACCCGAGACGCTGGAACAGCAACTCGTGTGTCTGGCGCTTGTGGCCATCGCAGACCCGCTACGTCCCGGAACGCGAGAGGCTGTGGCGTC
CTGCCAGAAAGCTGGCATCGTGGTGCGAATGGTCACGGGTGACAGTGCTCTAACCGCACGTTCCATTGCACGCGAGTGTGGCATCTTGACGGAGGAGGAG
GAAGAAGAGACGTACACCGTCATGAAAGGACCGGACTTTCGAGCGCTTGTGCTAAATGCGCATGGACAACTACGACAGGAGATCTTCAAGCAGGTGTGGC
CTTCTCTACGCGTTCTGGCGCGTAGTTGGCCACAGGACAAGCGCACGCTTGTGACTGGACTACGAGCTTCAAAGCTGATGCTGCAGCAGCTGGTAGCTGT
GACGGAAGACGGGAGACGGCACGAACGATGCACCGATACTTCGAGCTGCCCATGTAGGGTTTGCCATGGGCAAGAGCGGCAGGTCTGTGGCCAAGGAAGC
AGCGGATATCGCGTTGATGGACGACGATCTGACAGGCGTAGTGAGCGCCGTCGTCTCCGGACGCGGCGTGCTCGACGGCATCTCGCAGGTTTTGCAGTTT
CAGACAGAGAAGGAAAAAAATAAAGTGGTTTATCCGCCGGAAAAAAATTGCAATCAAAATGCTATATTGCGAGTACCGATGAGATTGCAATATAAACTGC
AAAGAAAAACTGCAATACTCATCTGCACTAAGTAATCG