Description :
From Genome Similarity Track
Location :
Scaffold_2082:1465- 3296
Sequence
1831 bases(100 bases per row)
GTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGATTGCCCGGATGGGATGTTGTACGGGCCAGATCCACTTA
CGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATTTAAAACGGCTGGTGATTTGTGGG
GATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTT
GGTTGAATCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTCAGCTATCGGTTGCACTAAGGTAATCAGCTGCCAGCTCCCTCG
CTTTATCCACCCCCTACATTCTACTCGATACAAAAGTAAGTTTACAGATCTTAGCGACTCTGAGCATTTGATTGCCGATCAATCATCGCTCCTAGAAGTA
CTTTCTTTGACTGAAGCAGCAAAGAAAACTGAAGAGGTCGTAATCCAAACTCTGCTACTAGGGCACATTTTCTTTCTTCAGTTTACAAGAGCTAACGCGG
ACGGAGTGCTCGTCTAGTCATTACGCCGGAAATTGATGTAACCCTGAAGGAATCAGCAGCAAGGCTTCGTCACGAACAACCATCACTACAACTACAGGTC
CTCAACCAGTAAATGGCTTCGTATAGTTAGAACCCTACCGTCCTGTACTGGTCGTTCAGCCCAAGCCGCAAGACGACCACCAGCAAAGAAACCAGCAAAA
CACGCGAGAGCAGAACGGTCTTTTGACTTACGAAAATCTTCATCACGGCAACGGAAGAAACAGAGGTCGTGGCGCTCGAATCCAAGACGATCACCGTGAC
GATGATACCGCGTACAGCCACCCTATGAAAGAATTTCTCAATCTGACCTCGCAAAGACTCATACCCATGTTCCTGGTCCTGGTACTTATCTTACCAACGA
TCCACCAAGGTTGCATACAGCTTGTAGCTCGCGCCGAAATGAGCGCTGGCAGCTCGTTTCAGTTTGGCAGCTCATCCCGCCAATTGGTATCTATCAAGCG
CTAAGCTTCTCAATAAACACGCTGTGTTTTGTGCACGCCACATCCCATATCCGCTGAGGACAAACCCGCACAGGGTAGCACAGCATATGAACACGTGTCT
TTCACAGGAGCTAAGCGGATATTTGCGTGAAAGTGCTAACTTGCTGAAGCGCAGCGTCGCCACCTACGACGAGAATACTTGGATGTGGCGCACCAATGCG
AGCAGCAAAATCGCGATTGTACTTCTCCAGCGGGTTATTAGTCCGATTTATCATGCTCACATTGTTGCGCCGCATCTGGCTCACGTTCCACAGCGACGTG
TCGAACCTCTTTGTCCACGTTCGCACAAAATACTTCCAGAAAGCGTTCCATTTAGTCTTTGCTGCGGTCTCATCGATGATGCTTCGAACATACCGTAGTC
CCTGCCAAAAAAAATTATTTTATTTTAGTAATATTTTCCGTAAGTAAAATACAAAAATTACGTACCTTGTCCAGCACTTCTTCGGCAGGAATGACAGTAA
GCACGTCCAGTTTTCCCGACTTCATGGCGTCTGCGATCTGTTCCTTGGGAATCTTCAGTTCTACCATCTTCCTACGTAGAGCCTGCTTCCAGTGGAAGAG
GCAGCCAACAATGTTGGCTGCAGGGAACTGCTCAATCACAGCGTTAATGAGCGCAAGCTCAAAGTCACAGGTAACATCACGAGGCTCCAGCTGGCGGTCG
GACGCCATGATGAGCTGCTCTAGTACTCGCC