Description :
From Genome Similarity Track
Location :
Scaffold_3675:1465- 3010
Sequence
1545 bases(100 bases per row)
GCTGGAAGCGAACGGCTTGGTTTTTCGCAACAATGCCAGTCGGTGGGCCTGTGCGGCACACCCTGTCAAGAAGCAGGGCAGCGACGAATATCGGATCACT
GTCGACTATCGACCGGTCAATGCTCTAACTGTACCGTTGGCTGGTGCAACACCGAACCTCACTGCGGTCGTGCAAGGTGTGCGTGGCGCTTACGGGTTTG
GCAAGTTCGATTTTTTCAAAGGCTTTTGGCAACTGCCGTTGGACGAGGGGAGTCGAGAGCTGTTCAGCTTCGTCACTGAGGACGGTGTGTTCACTCCCAC
CCGTGTGCCACAGGGTGCAGCCGATTCGGCGCTGCACTTTCAACTGCAGATGCATCAAGTGTTCCGTGATCAGCTGTACGACTCTGTGCTCGTGTGGATC
GACGACGTGCTGCTATTTGCGAAAACCCCGGCCGATTTCATCGAACGACTGCGCGTTTTCTTTCAGATCCTTCGCCAGCGGCGACTGAAGCTGAACGCTA
AGAAGTGCAAACTCTTTGCACCGCGAGTGATCTGGTGCGGCAAACTGGTCGACGGCGAGGGGATCCAGCATGACCCTGCTCGGCTCGAGGCACTGCGTGC
GATGCCGTTGCCACCTACCGCCGCTGCGCTCCAAGGATTTCTGTGTGCCATCAACTGGCTACGGGAGTCCATGGTAGACTATGCACGCCTCGTTGGGCCA
CTGCAAGAGAAGCTGGAGAAAGTGATGGCCGCGCGAGGACGCCGCAAGACGCAGCTTGCTGGTGTTGACCTACCCTGGAGCAAGGATGAGGAAGCGGCTT
TCAAGGTGGTGCTGAGTATGTTGGCTACATCCACGAAGACGTATTTCGCTGATCCCAGCGCCGACGTGTGCCTGTTCACTGACGCCTCCAACGTCGGCTG
GGCAGTAGTGCTAACGCAAGTGAAGGACTGGCAGCCCGAACAGCCAGTAGTGGAGCAGCTCCATGAGCTGCTGGTCTGTCGGGCGGGTCTGTTCAAGGGG
GCCGAAGCAAACTGGTCGGTGATCGAGAAGGAGGCCTACCCGGTCGTCCGTGCATGCTCTGACCTAGCGTATCTACTCGAACGCGAGAAGGGGTTCCGCA
TTTACTGCGACCACGCCAATCTGATCCAGGTTTTCTCGCCTAAGAAGGAGGTCAAGGCCCATGTGCGCGGCAAGCTCCAGCGCTGGGCGTTGAAGGTAGT
AGGTCAACGCTACACTATTGAGCACATCAAGGGGGAAGACAACATCTGGGCCGACATGATCTCGCGCTGGGCGCAGCCACCGCAGTCGGCCACAGTGAAA
CGAACCACGGCACGTACGGCGCCGACGGTGTCTGAGCTCCGACCGCTTCAGGACCCAGGTTTCCGCTGGCCGGCCGCGGACGATATCCGTCGCGCGCAAG
CCCGTGCTCGTGGTGATGCTCCGGCCGCTGCTGTCGAGCAGGAAGGACTGTTGCGCGTTGACGGACGAATTTGGTTGCCGGCCGATGCACGCGATCTCGT
GCAGCGTATCATGGTGGTCGCTCATTGCGGCCTGCAAGGCCATCG