Description :
From Genome Similarity Track
Location :
contig_55:146487- 147948
Transcript NameFunction/comments
g10951.t1hypothetical protein

Sequence
1461 bases(100 bases per row)
TCCACTCGCCGCCTCGCACTCCCTCGCTGTATCCTCCCGGATCCGACATGGTGTCTCTGACGTGTCCCAGTATCTCGGGCACTCCCAGTTCCAGCACTCC
GACACGTCCCAGTACTCCGACGCGTCCCAGTACTGCGGGCACTCCCAGTTCCAGCACCGTCGGGGCTTCTACGTCATCTGCCAGCGCTACTTCTCCGGAT
CGCGCACCAGCAGCTGAGACTCGTTCTCCGGTAGTGCCGACTCTCCCAATCGCTCTCCCGCACGGTGATCGCGGGGCGGCCCGCAATCTCCTGGACACCT
TCGCGGACCTGTTAGCTCGCGCCGATGCTCAGTCCAGCCTGGAGGAAGATCATGCAAACCTCCAGCGCGCGTATGTTGCTCAAAGGGAGCGGGCTGATCG
CCTGGAGCGCGAAATCGATGCGGCGTATGTCAACGCGTCCCCTTACGTCTTGTTCTGCCAACGCCAATACGACATCCTCTACCGCCGCTGTCAAGACGCG
CAGCGACTGGCTGCAAACTTCGAATGTGTGGTGCGAGAGCGCCTTGACAATTCGCGCAAGATTGCTGCTATCCGTGACCGGCTGCGTCTCGAGCAGGACG
TACACACGGAGGAAATCGCGCGTCTGCACACGGAAATAGACAGCTTATGTAGCGGGGCTACACATTCGGTACACCGCCTACCTTAGTGCAACACGCACTA
AGGAATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATTAGAGTCATTCA
ATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCATTTTTAGGAGGAAACCGCATTTACAATCAATAGAGTTCTCATTTA
GCACCAAAGCTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACTCCTACACTTTCTTATACA
CGTGCGCACACGTGTAAGCTAAAGTAGTGGGTCTAAGCAGACCCATTACATTTTCTACGGCTTTACAGTAAACCTTAACGTCGCGATCGGAAACAGTGGA
GCGGGGTAAGCGATGCAGACGTTGGTAAAACTCACGAAATAGTACGACAGTTTCCTTGGTGGTCGCATTCGACGTCGTCGGTTGGAAATGAGCTCGTTTC
GTAGGTCGGTCCACTACGACCAAAACTGCGTCAAAACCACTGTGCGTCTCGGGTAATTTCGTCATGAAATCGGCACTGATGTCTGTCCAACGTTGTTCTG
GGATCCCGAGCGGATAAAAGTGTCATGTTGGTTTTCCTCGGATTCACTTGTTGCGTTGACAGAGTTCGCAATTTTCTACGTAGGATCGCACTGACTTGGC
CATACGTAGCCAATAATATTTAGACGCCACAAGTGGTTGCGTTTTGGCCTGGCCAGGATGT