Description :
From Genome Similarity Track
Location :
contig_55:146483- 147944
Transcript NameFunction/comments
g11467.t1hypothetical protein

Sequence
1461 bases(100 bases per row)
CTCGCACTCCCTCGCTGTATCCTCCCGGATCCGACATGGTGTCTCTGACGTGTCCCAGTATCTCGGGCACTCCCAGTTCCAGCACTCCGACACGTCCCAG
TACTCCGACGCGTCCCAGTACTGCGGGCACTCCCAGTTCCAGCACCGTCGGGGCTTCTACGTCATCTGCCAGCGCTACTTCTCCGGATCGCGCACCAGCA
GCTGAGACTCGTTCTCCGGTAGTGCCGACTCTCCCAATCGCTCTCCCGCACGGTGATCGCGGGGCGGCCCGCAATCTCCTGGACACCTTCGCGGACCTGT
TAGCTCGCGCCGATGCTCAGTCCAGCCTGGAGGAAGATCATGCAAACCTCCAGCGCGCGTATGTTGCTCAAAGGGAGCGGGCTGATCGCCTGGAGCGCGA
AATCGATGCGGCGTATGTCAACGCGTCCCCTTACGTCTTGTTCTGCCAACGCCAATACGACATCCTCTACCGCCGCTGTCAAGACGCGCAGCGACTGGCT
GCAAACTTCGAATGTGTGGTGCGAGAGCGCCTTGACAATTCGCGCAAGATTGCTGCTATCCGTGACCGGCTGCGTCTCGAGCAGGACGTACACACGGAGG
AAATCGCGCGTCTGCACACGGAAATAGACAGCTTATGTAGCGGGGCTACACATTCGGTACACCGCCTACCTTAGTGCAACACGCACTAAGGAATACATTC
AGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATTAGAGTCATTCAATAGATAGGGGT
TCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCATTTTTAGGAGGAAACCGCATTTACAATCAATACAGTTCTCATTTAGCACCAAAGCTA
TCGTTCGGTCCCTTTATCTTAGTTTAAGTATACTTGCGGATACGAGTATACTGAACCTAAGTAAATACACCTACGCTTTCTCATACACGTGCACACACGT
GTAAGCTAAAGTAGTGGGTCTAAGCAGACCCATTACATTTTCTACGGTTTTACAGTAAACCTTAACGTCGCGATCGGAAACAGTGGAGCGGGGTAAGCGG
TGCAGACGTTGGTAAAACTCACGAAATAGTACGACAGTTTCCTTGGTGGTCACATTCGACGTCGTCGGTTGGAAATGAGCTCGTTTCGTGGGCCGGTCCA
TCACGACCAAAACTGCGTCAAAACCACTGTGCGTCTCGGGTAATTTCGTCATGAAATCGGCACTGATGTCTGTCCAACGTTGTTCTGGGATCTCGAGCGG
ATAAAAGTGTCATATTGGTTTTCCTCGGATTCACTTGTTGCGTTGACAGAGCTCGCAATTTTCTACGTAGGATCGCACTGACTTGGCCATACTTAGCCAA
TAATATTTAGACGCCACGAGTAGTTGCGTTTTGGCCTGACCAGGATGTCCGTGGGCTGGAG