Description :
From Genome Similarity Track
Location :
Scaffold_527:14645- 16334
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_527-fgenesh-gene-0.2Nitrilase
Pytve_DAOMBR484maker-pve_contig_527-fgenesh-gene-0.7Purine-cytosine permease

Sequence
1689 bases(100 bases per row)
CTAGCCCATTGTGCATTTCGCCAGCAGTCGCACCTCGAACCCCCAAGCGATCCTTCACAGCTCCTGTAGCCCCATGCCGTCCCCCCGCAAGCCGTCGCTG
CTCAAGGTGGGCGTGGCGCAGACGGCGTCCAAGCAGTTCGACTTCGCCGCGACGCTGGCCGAGTTCCGCGCGCGCTGCGAGGAGGCTCGCGCTCAGGGCG
TGGAGCTGCTCGTGTTCCCCGAGGCCTTCTTCGGCGGCTACCCCAAGTTCAGCAGCTTCGGCGCGAGCGTCGGGGTCCGCGCGTCCGCCGGCCGCCGCGA
CTTCGCGTCCTACTACGCCGGCTCGATCGCGGTGCCATCGGCCGAGTCGGACGCCATCGCCGCCGTCGCCAAGGAGCTCCAGCTCGCCGTCATCACGGGC
TTCATCGAGCGCGAGGGCACGACCGTCTACTGCTCGCTGCTGCACGTGGACCCGGAGCGCGGCGTCGTGGGGGTGCATCGCAAGGTGCTGCCGACCGCGG
CCGAGCGGCTCATCTGGGGCAACGGCGACGGCTCCAAGGCCAACCTGACGGCGCATCGGCTCCAGCTGCGGGGAGTGAACGAGGCCGTCGACGAGCCCAA
GCGCGAGGTGACGGTGGGCGGCGGCATCTGCTGGGAGAACATGATGCCGCTGCTGCGCTACCAGTACTACCAGCAGGGCGTGCAGGTGTACGTGGCGCCG
ACGGTGGACGCGCGTCCCAACTGGCTGCACTCGATGGTGCACATCGCCATGGAGTCACGCTGCTTCGTGCTGTCGGCCAACCAGTTCGCGACCGTGGGCG
ACTTCCCCGAGTGGCACCAGAGCACCATGCACGCCACGCTCGAGCAGCCCGGCAGCAGCGAGTTCAAGCCCGCAGACTGGACGCCCGAGACGGAGATCAT
CGGCGGCGGCTCGTGCATCATCTCGCCGCTCGGCGAGGTGCTCGCCGGCCCGCTGCGCAGCACCGCCNNNNNNNNNNCATCTCGGCCGAGATCGACCTGG
ACGAGATCGTCGGCGGCCGCTTCGACCTCGACAGCACCGGCCACTACTCGCGCTCCGACATTTTCAAGCTGCAGGTCGACGGACGATCGACTCCGTGATG
GTCTTGTGCTCGGTGAGCTGCCATGCGTGTTGAGGTTACAATTTGGTGCATGTTTGCATTCTGACAAGGCAAAGCAGTTAATCGCAACACGCTTTTAACA
CTAGTCACTACATCGAACAGCGATGCCAATTCGTGTTGTTTAGGAAGGAACACGAGAGCCAAACACGCCTGCAAGACACTGCCAGAGCGCTATCCTCTAC
GGCTCGAGCGTCACGGAGAAAGACTCTCGTCGGTCCGATCTACGTCGAAATGGCCCAGATCGCTCACGTATGGCTTGTAACATGACAGATCCAGGGCCAC
TTCGCGATTCATGCTCGGATCTAACGCTTGAAGTACTTGAGCTCGATCGGACGCGTGATGATGTACGCGACGAACGTGAACAGCCAGGCGAGCTCGATGC
CGACGTCGCCACCGTACGGCGGCTCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGACGTACCAGGTCTGGCTCATGCCGAGAATGGCA
CCGACGGCACCGCAGCAGAACGAGAAGATGGCGGCGAAGCCGTGCGGCAGCTTGTGTGGCTTGTCGTGGTCATCCACGTCGTAGCCGCC