Description :
From Genome Similarity Track
Location :
Scaffold_77:146434- 154301
Transcript NameFunction/comments
Hyaar_Emoy2808260hypothetical protein

Sequence
7867 bases(100 bases per row)
CTCTAGTTTTTGTGACTCTGCATAGCTTCGAACCGATTATGGCTCGTCTACATGGGTTCAAACTTTCGAAGTAATGCTCCACCGTTCAAACAAGTTCATC
CACCCAGGAGGAATTCTTCGTACCCCTTCTAACGAACGAGAAACTCTCGTTGCTGTCGCCCATAACGTGTTTTCTTACCAGTGCGGCTCTCCAAAATCTC
ATCGACTCCGTATTCACCCTCTTCCAATTCTCGAACCCAACTGTCTTCCGGCAGTAGGCATTAGTCAAAATTAACCCGCTCTGCTTGGTTCACTGTTAGC
TCGTTGTCGATCAGGGAGTTTTCCTGACCCGCTTGAGCTTGGATATGTATACAACCGGTAACAACCGGTATTCCGCCCCCCGGGTTTCCAGACGTGCGGC
ATGGTCTCCCGCCAACTCCAGAACACGGAAGGGTCTGTGCCAAAGATGAGCCAGTTTCCTGGCATATTCTTCTTTTACTCGGTCGAGATAGAGTCATACT
TGGGCTCCCGGTCAAATCTTGTGGTCGACCACCCCTTCATTCTGCAATTTCACTCGCATCTGACTCGCCTCTTGCAACTTCTCGTCCACCTGTTCTCTTG
CTCGCTGATACTGGCTTTGAATGCGGTACCTCCACCTTCTGGGTTCTGAATCCTGACGTCGGACGTTCACTATTGGTAGTGTGGCTTCAAGGGTGGATCT
TGCATCCCAACCGTGGACCAAATAAAAAAAATCTTCTCGTACCCGGTCCCGGTGACCGCAAACGTCAACGGCTCTGCGTACTTGTCCTAGTCCCGTGGCC
CTACGTCCGCAACGTACTACTTGATAGATCTGGTTTGAGTCTGGACCATCCTTCCCGCCATACCATTAGCTTGGGGTAGGTAGGCCATTGTCGCTCGTTG
ACGTTGACCCACCATACGGTTAAACGCTCGGAAGACGTCTGACACGAATCCCGGTCTCGGTCGTGATAGATCGCCTTGCTATCCCCAAAACGACGAGAAA
AGCAATATTCATATCCTTCAGCGACCTTCTGAGCTGTCCGCGACGCGCTAGCCTTGGCCATTACGTATCCGGTGAATAAGTCAACCCATATCATAAGTTC
CGTATTTCCTTTATACGACTTAGTCAGGAAAGGGATATGGTCCATCGCTATAACTCGGAAAGGAGAAGTCGCTTCGATATTTCCAGGCTCTTCCCTTGCA
GGTTAGGTCCCCCTTTTTCAGTCTCACAATCCATGCAAGAACCAACGTATCTCTGCACACTCCGAAACAGACCTTTCCAGCGACAGTAACGTCGTATGCG
TTGGTACGTACGCCCGATTCCTCGATGACCTCCTTCTAAACTCGTATAGTAGTGGTGGAGGAAGTCGTTCTGGAGGCTTTTCGGTATGACCAGTCTGACC
GTTCTGTCACGGTCTTTTCCCTTGACTCTAGAATTTGGAAAATATACCAGCAATCCTTCCTCGTTTACATCGTAATCTTCGTACATTTTGTTGCACTTTT
TATCGGATTCCAACGACAGGTCATTCCAGTCTTCTTTCAGATATGCCTTCAAAGCTCGTACCCAGCTCTCCTCTTCTTGCGCCTTTCGAATTCGTTCCAC
GCGGAGTCGCTGTACTACCTCCTCTTGCATTATCTCTCCGGATATCCTAATAGAAGACCGCGACCGAATTACCGCAAAGATATTTTGGTCATGAGGTTCT
GGTCTTTAGGAATTCGCAGCTCCGGTAGACGATTGATCGCTTTCAAGCCTGGTCTTTCTTCGACTGGCACCAACTTAGTCCCCCTTTTTGGTGCAAGGCG
GTTCTAGCCAACTGATCTGCGCTCTGGTTCCAATCTCGTTTCACATGCAGGATCCCGTGCGAAGGCCACGATTGGAGTTCGTTTAAAGCCCGTGCTCGTA
GCGGTGATAGACCCGAGGCCTTACACTCAATCTCACCTCGCATCTGCCGCACCACGAAGTTGTAATCTCCACAGATAATCAATCGTCGCCGCTCCAAAGG
TTTCAACAAGCTAAATATACCCGCATATTCCGCCTCATTTACCGTAGATGTATTGTGATATTTGGAGGCGGCTTCGACTATGGTCCAAGTCGAGAGTCTC
CATACGATAGATCTACAATCCCTACCTCCTTGCTTGACACGTGCTGACCCATAGAAACTCATTACGTACAGTTCTTCGTCTAGTTCCACTGTAGGGGTTG
GTAGGTCGATCGGCTGCCTCGCCTGATTCTTAGTGGCAATGGCCGACAGTACTGAGTCTACACTCTCTCGAGGGGTGGCACTGGCTGCCAACGCCCCCAA
CACCTGGTCTTCACCTTTTTCACACTTTACTATCTCCAAAGTTCACTGAGACAAGAGAGTGGCCAAGTTTCCTAAGCGTACCTGCAAGCTGGTAGACTTT
ACCAACCATGCCAATGTCAATTTTCTTGTCAAGACTTTGAGGGGCCTAGTGACTAGCATAGTGGAGCAGGTCTCCAGTATACGTAATAGGTCCAACACCT
CTTTCTCCACAGTACTGTAATTTAGTTCGTTAGCCTTGAGGGTTCTGCTTGTAAAGGTTACCGGTATAAACAGTCCTTATTAATACTGTACCAGTGACGC
CGAAATGGCCCATTCACTCGCATGGACAATAATCACGGCTTCTCTGGTTGGGTCGAAGTGTCTCACAATTGGTGCCGTGGCAATTTTATTCTTTAGCATG
GAAAAGGCTACTTGAACGCGGTCCCACCTTTCTTCATTGTCATCCTGGGAAGTGGCATTATTATGTCCCTTCAACTGGTTTCGTCGGGCATGAAAGTCTA
CTTCTCTCAATTCATAGAGAATAGATGCATACACGGTAGTCCTCAATAAACCTGCTATAGTATTCAAACTTCCAGAAAATATTGCATGGCCTTCAGTGTT
ATTGGTAAGGGTAGGCAGACCAGAGATTGGAGGACTTCTGGGTGAGCCTCTAGTCCTCCACTGGATACTCGATGTCCAAGGTAGTCGACCTTCCGACATC
CCCATGAGCTCTTGACTGCGCTGATTGAAAAATTCCAGTAGTTGCACACATCCAACAACCGCCCCCCTTTTGTGCATATTTCATCCCATGATTCTACGGG
GATCAGTATGTCATCTATATATGACCGCCGACCCAGAATAGAGGGAATCGACTACTCATCTGGCTCTCCCACCTTGAATAAATTCTCGGACCCATCTTTC
TCCGCTTCTGGAGGTATTCGTAAAAACCCGTATAAAGCGTTACCCAGGAGTCGTTGATATATTTGGGGCGCATTCTTGAGCCCAAACGGCATTCGCATCC
ATTCAAACAAACCCATTGGGGTAATGAACGCCGAAATTCGTCTCGCCCTTTCATTCATACCGACTACCCAAAAACCACTCGCCATCCAATGAGCAATACC
ATAATTCCTTGTCCAAATCTTCCAGTACTTTAGTAATCAGAGGCATGGGGTAGCCATTAGTTGAGTCAGGTCGGTTACCAACCTGTAGTCGATGCATAGC
CTGACGTCCACCCCATTTTTCTTCACAATTAATAATGATTGGGCTGGCCCAGGGTGACGTCGAAGGCTGTATAAACTTTGCTGATAACAGCCCCTTGATC
AGATCGGCTAACTTTTTCTTAAATTGGGGGGCCACTTTACGTACGCGTTGCGCGATCGGCTTTGCATTTCATACACCTCGACCTGCTGGCCGTAAGGCAT
TACCTTTCCCCATCAACAGATGTCGTCTCTTCCAAATGATTTTTCGTAGCCTGTCCACCTCTTCTGGAGTGTTCCATCCGGATCAGGGATCTGTATATCT
TTCAGCTCAATATATTCGGAGGAGGGGTCCACTTCTGGTATAATTGCCCACCCTCGGATTATTTCATCGGCCCACAGGTCTCCGCTTTCGAATGTACACA
CTTGTTCGTCGTCTTGTGGCGATTCGTTGGCCTCGGCCTCCTCTTCTTCGACTGCGATTTCTCCTGGTGGATCGTCTTGGGTCACTTTGTACTTGACGGG
TCTCTCCTGGTAGGGGTACCTCTTCTTTGCGTGACTATTCTTTTCTCTCTGGTGATGGCTGGTGTGACACGTCCATCATTGCGACTGGGTGGTATTTAAC
CGCTGCGAAATACGCGACGGAATCTTGTACTGCGGGGTCTCCACCATTAATTTCTCGTCTTCCTCCTCGAGGTCAACTTGCGGGTCGACCTGGTCGGTGG
TGGTTTCGTACGCTAGTTTCAGCCACTCAGCGTACATTCGAGAGCCTACCGAGACGAGAACTTGTGCTCTTGGTACTTAAAACTCTGTCAGCCACATGCC
TATCTTGGTATCATCATGTAATATCAACGTGTGGGGATGACGTTGCTCACCTTCAGCAATTGTTGCCTTCCTATTCCCCAGGATATAGTTGTAACTCATC
GCTCCCCTCTGGTGACCCATATTCTCCATAGATATGAGATTGACCTTTTAAGGGGTACCTCCACACCTCCACCGGCAAGTATACGGGCATATTGTCCCAA
CTTCACGTCTGCGAATCGGTTATCGTAAACGGTCCTTCGTCCGGAGAGCTGTATCTGGAATTCGTTGGGAGACAGAGTGTTCCATCCGCCAGATCTAGTC
GGATCCCAGCCGGGACCATGAAATCCATTCCTAAGATTGCATCCTGACCCAACATAGGGCCTACCCACACCTTGAACACATACATTAAATTTCCATTCAG
GGTGACCTTAATGCGAGTGCGTTCTTCCGTAGAGTACACCGATTCTCCAATGCCATGCATTCTTGTCGTTCGCTTTTGTCAATTTGGCAGCCTACCTTAC
GAGCAAAGGCGACATCCATAATGGATATCTCAGTGCCAGTATCGAACAATAAATTTGCGCGATCGTTGTTGATACTCCCAGAGGCTTTGGCTTGTTTAAA
CCACTTTGTTGGGGCGTGGTATTTCCAGTATCCTCAGGATTCTCCAGGCAATAGGTCTAACTCCATCACTGCATTTTCCCAGGTGAAAGCATCAGGTTCA
TTGTGAGAGACAACATGGACCATGGAATATTTCCAATCTTCAATATAATATCGGTCTTCTCGAAGGAAAACCACATCTCCTTCTCGGGCTGCTTTTCCAC
ATATGCAAAGATACAGAAACTAGAACGCTCGACTCGTACCAGATTCAAACCTGGCGAGCGTTCTAATTTTTTTATCATCCTCTCCGCTTTCTCGTTCAAC
ACTCCGACGTGCTTGGTGGGGTTGTACCATTGACGAAACAAGTTGTAGAATCCCTCCAGCTGGCACTTCCCCGCTTCATGGGTCTCTCCGCACTCCCGAC
ACACGAACAAGCAGCGATCCGATGGATGTTTCTTCTTTCTGCGATGATCAAAGATCATTCTCTTCCAGTATCGCAAGTCTCCATGTCTCCTGGCTCGCAG
TGGGTGCATTATACGTTTGACTTGGCCGACGTATTGCGGGTTCCTGGGTCTTCTGCTTGTTTCCGATGTTGGCCGACCTCTCTTGGGGGCCGTTACCTCG
AGGTTCTTGGACTTGGGTCCCTTTTCGCTTCCGCTAGGTAGATCCATCTCAGGTCTCCCTCGTTATCCAAATTATCCAGGCTGGATCCCTCCGAGCTCGA
CTCTTCTAGTGTCGCTCGGACTGCATGCCCGAACAGCGGTTTACATCTCTAGGTTGATCCGGAGGTGCAGGTACCTTCTGCCAGAACTTTCTGGAACCAA
ACAGCGTCTTGCCACGTCGTGCCTTCGGCTTCTGGCGTGTCTTCAATACTTCCTCCAATTATTTCACGTCTGCCAGGCGTAGCATCGTCAATTGGTCTGC
CAACTCTGGGTCGTCTACGGAATCGATGTAATGATCGACATGTTCCTTCTGGATGTTGGGTGATCCATTCTTAATATTTAGCTTCACTCTGAGAGCAATC
AAGTTCAGGCGGTACAGGTAGCCCGACGGGGATTCGCCTGACCTCTTCTTCGCGTGGTAGTACTGGCGGGCGACTGGTACCCCCAGACCACAAAACTGCA
TCTGAAATCCTTGAAGCAGGTCCTTCCAATTTCCTCGAACGGAACGGCTCAATTGGCTACGCCGGCCCGATCATCAGTCCTCCGAATACCAGACACTTTA
CGCTGTCCGGTCATTAATTCCTTGCGAAGGCCGTCTTCACTGTGGCTACCCAACTGCAAGCTCGGTCCTCGTCCAGGTCTCGACCATTAAACTCTTTGAG
GTCCGAAGTTGTAGAGAGCCTGATGCGAGGGACCATGTTGAGACCCTGTCACATCGTGGCATTGGCCATCCTCCCCGGAGTTTCCTCCAGGTCCAGATCA
TCCGGGTCGTATTCGCACGAGCCGACCGATTCCATGTCGATGTCCGACATTGTGGGTTGTCTTTGGGCTTGTACCTCTTTCCTCGGACCATTTCCAGTAG
TCGCCGGTCGTGCTCCCTGCCTCTCTCCGGCTTCTTCTCGGTTAGGGCGTGTTGATGGCGCTTTGCATTATTGCAAGCACCTTTGCATCGCCGCGTCGAA
GTATGCCTGCAGATTACCTACCGGGTCGGTAGGCGCTTCCCCCCCAGTATCTTCGCCACGTGGCGGTGCTAAGGTTTTGGGATGATTTGGTCAGTCCGTT
ATTGGGAGAAATTGTGGCCTATCAGGAGTCCGCATTTCCGTTGGCTGTCCACGCGTCGCCCCCTCGTTATCAGGATATTCCCCTAGCGCATCTCGCGCCA
CGGGCCTGAAGTAAAGCGGTGCCGGTAGGTCCCAGTGAGATTCGGGAGACGTAGCTGGGCATTGAGGATCCTTGTGACGAGTACTCTGCTGAGGCCTGGG
CACGTGAAGACTGGGTTTCGCGAGATGGTGGGTCAGTCGATCGTGGGTCCCAGGTCACTGCTTGTGTTAGGGGGTGAACCTCGATGTCCTGGAGAGTCAT
TTGACTGTTTTTCTTTGGATCGTACACGTCTGCGGCGGGAGAAAATGTGTGTCCCGTGCGGTTTATCCCGACAAGAATTCCCGCACGCTTGTGTAGTTTC
CCTAACGTTGTTGTGATACTGTCGTACCCCAGGGCAAACACTTCGTTCGGTTCGAACCTCTCTGCGAACATGCCTGCTTCCCGAAGAAATGTCACTAGCG
CGGTAATTGCGTCTGTGATCGTCCGTACCTTTGGAAGGGGCGACAGTGGTCCGTAGAGCTGTCAAATAGCCGGTTCTCGAGGGATGTCGTCACCGGGTCG
CTGGTCTGGAACGTGTTGAGCTTACGTCGGTGGTAGACCATCGTTATCTCGGCGTCCGACCAGGTTGGCGGCCCTGAGCGTTCGGGGTCGGCTGACTTGG
TCTCGGGTCTTGATGGCCCGAAACATACCGACTTGGTATCGCGGGGTGCCTTCATCTTAAAGTGTTTCGGCTTGGACGTTGCGATTTTTTGTCGTTGTTG
TTTCGGGGACTTTGGCATCTCGACTTTTGCCGTCTGATGTTGGTCTTCTGGGGTATGATAGGTATCATGACACAAGCTGTCATCTGCGAGGACATAGGGA
GGTTATTTAGGTTTCTCTTCGAAAAGTTCAACCTTGACCTTGTTGACCTGGCCCCTCTCAAGAACCGGTAGGTACTTCGATCCTTGTCTTATTCTTTTTT
AGTCACTGTCGATCGGTCCTCCAGTGATGCTTCAGTCTTTTCCTCAATCTTGACTTAAGCATCTTCGTCCCCTTGGGACTCGCGGAAAAATCCCGCGTCT
TCCGAATATCCGGGCAAGCGCACCATTGTGGTGGAGTGGGTTCTCAAAACTGCGTCTTGAGCCTCCGAAACACTCACTGCGACGGACTCCCGACTTACGG
GGGTGGTACCCCGATTCCGCGTATGTACTCACCTTGTGTACCCGTCGGCTGGCGGGTTGCATTCTTC