Description :
From Genome Similarity Track
Location :
Scaffold_3:1464181- 1469027
Sequence
4846 bases(100 bases per row)
AAGCAGAGTCGGTCCACATCCCATGCGTTGTTGCAGACCTTCACGCGTAGCTCTCCAATCAAATGATCCGCGAGGATCTCCTCGCGATACGTCAACCAGT
CGACAAAACTTTCTCCAGCACGCGACATCCGGTTCCATCGCCGGATGAAGGCACACCAGGAGCGACGAAGTCCCTCACGATCAGCGCCTTCAATGTATTT
CTTCCGCGTCGCGCGGAAGCGACGAGAGTGGTTCTTCATGGTGTCGAGCGTATCCGGATTCTCCGCTCCTGACAAGTCGTACAGGTCCCAGGGAACCAGG
GCGTCGTCCATCACGCGCGACCGCGTGCTTCCGGCGCTGATCCTCGTGACTGTCGGCTCCGCCGGTGTCTCGGCTGTCTGGGTTACCGCCGCCGTTAGTG
TGTCGATGCTTGCTGCTGTCACCAGCGTCGCGCTGGTGCTAACTGCGTCGTGTTGTCCTCGGCCATCTTCGCTCCGTTGGGTTTTCGAGTTTTCTTCAAA
TGTGTTCCGTGCGCTTATGTTGCGTAAGCGCAACTTAGAGAGGAGGGTGATGTAATGGGCCCAACTCCAATTACATAAGTAGGTAGATATTTCTTTAGTT
ATTACATAAGTAGGTAAAGTGGCACACGGGTAGCGTGTGCCAAGGTGTCATCATCTGATTGGTTGATAGTGAGGAGCCAGACTCACTTATTGACCAATCA
GATATAGACATGTGTTTGAGTGGTTCACACGAGGCCAGGGGTAGCCGCCCTGGTCCTAAATAAATCAGAGTTGAATTTGACACAAACCTAAGACTTGGTT
TTATTATTGCGAGCTTCCTCCGCATTACAGTGTAAGCTAGTAACGGTATCTCTTACCCCGTTAGACTTTGTACCTACCGCTGGGGCGGAATTTCACCCGA
CGCTGTGACTGATGATCGAATTATGTCTGAAGTCAAGGCGATTGTTGAACGTGTTATGAACGACACGCTACCCGACATTGATCAGCTCTTTGGCAAGAAG
CTACGCCTCAAGATGTCTGAGACTGATGTCAATGAGCGTGTGCTACAGTTCATCATGCTGTGTAACCAATTGATCGACGAACACGGCTTGGTGACCTGTT
TTGAGGGACAGCACGGCCAAAAGGAAAAATGTAAGCTGCTGATTGAGTCACTGACGCCCAGTGAGCTCAAATCGGATGTGAAAGCTATCCGTTTCCAAGT
GACAGAGGCACGTTGTGACGAGTTCAAGCTCCACGACTTGATTCTTGAAAAGGCGTTGGAGCAGGATCGTGACTTTCGTCGTCGCAAACACTCACGCTAT
GAGGAGCAATTCGCTAAGTTTGCAAAATTGCAAAAACAACAGGATCATAAGGGTTTGAGTGATCAGCTTGGCCGCCACCAACGTGGTAATTAAGAACCTA
AGGAACATGGAAGCGGAGATGCTCGAGCGGCAAGGTCTATCGTTAAGCAAGACTCGGAGAAGAAGAAGCGGTCTCCTGTACCGAAGGACGGTTGTCTGAA
ATGTAGTGGCCCACACTATGTATCGAATTGCCCAACTGCGTTCCCTGAGGAGAAGAAGGAACTACCGAAGAAGTTTCATACTTCTCGTCAGGACAAGAGC
AGAATGAAGCGAATCAAGAAGCGTTTGGGTGGAGTAAACACCATAATGCTAAACGACGTATGTGAACTGCAGTACTGTGCGGACACGGGCTCCGATAGGT
GCCTGTTGAGTCAGAGCAACTTCAATGATCTCATACGTCTCGACGACAACGTGAAGTCTGTCCCGTTGAGCACACCAGTGATTGGGAAAGCTGTCGGTGG
CCATGATATGGAAGCTTGTGAATCTGTACTGCTTACAATCCAACTACACACTGCAGCTGGACCGGTGGAGCTTGCAGAACCGGTTGACTGTCTCATTATT
GACGAAAATGATGACGAATTTATCGTAGGCAACGACGTGCTACTCTCTCTTGGAATTAATGTGGACCGACAACTCGAGCAACTTGCTGGTGGTAAACTCG
AGGACAACGAGGACCCTATCTCGGGTGATGATGACTTTCGTCCTGGTCATGCAAATGATGTTGACATCCAGGAAGGGCTTGAGAGATTGTTCACTGCTGG
GCTTGAGAATGGGTTTCCAGAGGTTTGCATTGAGGAACTGCGTCGGGTCACGAAGAAGCATGACATCTGGCGGCTAGTACTTTGTGACGACCCTCCTGCC
AAGGTGCCGCCATACAAGCTTCGCTTAAAAAAGGATGCAAAGCCTTTCCGGTGCAAAGCTCGACAGTATGGTCCTTTGCAGAGTGCGTTCCTGAAAGAAT
TCAACAATACTTTGGTGGGCCTTGGCTGGGTTTACAAGAACCCGAGCGGCCACTGGGCTTGTGCAGCACTGCCTCTTAAGAATCCGAAAGTGAATGAGTT
TCGCCAAGCAGTGAATTACAAGCTGCTGAACGCGATGACTGAAGCCATTGCCGGTGTCATGCCCAACTCGAAGACCAAGTTGGGGTGTTTGAAGGGCAGG
AAACACCATGGTCTTTTCGATTTCATCCGCAGTTTTTGGCAGCTTGCTGTGGCGATGGAAAGCAGAGAGCAGCTCTCTTATATGACGGATGAGGGTGTGT
TCACGCCGACTCGTGTGATGCAAGGAAGCTGTGACTCGGCTTTGCATTTTCAAGTCTCAATGGAAAACTGTTTCGCTGAGCTATTGGATCAGCACCTGCT
GATATGGATTGATGATCTCTTGTTTTACTCGGATACAATCGAGGATTACCTTGTTGCGCTTGAGCGGTTGTTTGACTTGGTCAATGAACACGGATTGCAG
CTGAGCTTGAAGACGTCTTCATTGTATCAACGCTCTGCTACCTGGTGTGGAAAAGTGATCAACGAGGAAGGTGTCCGCCATGACCCGAAACGGATTGAAG
AACTAACTTTGATGCCGGTACCAGCCACAGCTGGACAGCTACAACAGTTTACCTGTGCAACGAGCTGGATGCGAGACAGTCTAGCTGACTATGCTCGTAT
TATTCGTCCGCTGCAATTGGTGTTGGATCGTGCACTAGCTGGTAAGCGAAAGACGAAGCGTGTTGCTCGAGGATCAGCATTTCTTTGGCTGATGGTGATT
TTCACAGTTTTTAACAGGTCAAGAAGCTCCTGCAGAGCTCGGCCATGATGACTCATCCGCATGAAGACGCCATCTACTGCTTGTTTACATATGCTAGCGA
GTGTCCTTACGCAAGTGGATAAATGGAAACAAGGAGTTGCAATTACAGAGCAGAAACATGAGCTACTGATCTGTAAGAAAGGTTTTTCACTGGTGCTCAA
CTTCATTGGAGCGTCATTGAGGAGGAGGCCCTACCGATCGTGCACTCCTGTGAAGATTTTGACTACCTGTTGCTGAGGCCCGGTGGTTTAAGTTTTTTTG
TGACCACCGGAACCTCATCCATGTATTTGCTCCCGGACAAGCAGTAAAGAAGCGCGTACGCGGTAAATTACTTCGGTGGGCGATAAAACCCATGGAGTTT
CGCTATACTATCGTTCATATCGAGGGTGCCAACGATTTGTGGGCAGATATGCTTAGTCGGTGGGGTGGGGCAGCTACTTCTATGATATCTACGACTACGA
TGCCTAGCCTGAAGCGAGTCACTCGCTCACAGACCAAAGTTTCTCGCAAGCCTTTGTTTCGATCTCTTGATCAAGAGAACTTCACCTGGCCGACGTTAAG
TGAATCGCGGCTACGCAAGCGGCTCATGTAGCTTCTGTTCCTACAGCTAGTGCTGCAGATGAACATGGTGTCTACCGACTTGATGACTGTATTTGGATAC
CTGCTGCTGCCACATCTCTCATCCAGCGACTTCTGATTATCGCCCATTATGGGGCACAGGGTCACCGTGGTGAAGCCGTGGTCTTGAACCACATCCGCCG
TGTCTTTTCGATTGGGAATTTCTGCTCTAGTTCGTCGCTTCCTACGCTCATGTTTGCTCTGCCAGCATGTAAAAGGGGGCAGGGTGGTGCCTAGACCATG
AGGTGAGCTGTACCGCTCTGACATTCGCAATGGAGCTTTGCACTGGGATTTTCTCTATTTGGGTGATGGATTTGGCTCATGCAAGTACCTACTACTACTG
AAGGACAACTTTACCCATTTCTGTGAGTTGATTGCATGTGATACACCAACAAGTGAGGTTGCAGTTGATGTCCTGCTTGGGTGGCACAGTCGGTTTGGTG
TACTCCCTGTATAGGTCAGTGACAGTGGCTTGCATTTCAAGAGCCAAGTTCTTGCCGAATTATGCAAGCGACTGAAATGTGAACAGCAGTTCGTAGTGGC
GTATAGTCCGTGGACCAATGGATCCGTGGAACGTGCAAACAGAGATATACTGCAAGGGCTACGTGCAATGATTATGGAGTACAAGATTTCGCACAACGAC
TGGATCTATCTTATACCTTTGGTGCAAGCTAGCATGAATCCCTCTCCGGTGGCTTCTCTAGCTAACAAAGCCCCTGTTGAGGTATTCACTGGCTTGCCAT
GCCCAGCGCCAGCGCCAGCCTACATCCTGCATGTACCTGACGATCAACCTAAGGCAGTATCTATTTCGAGTACAGCCATCGAGAAATCTTTGGCAAAGCT
ACGGTCTAGTATTGCAGACATGCACGGTGCTGTCAAGGACAAGCGTGAGAAGTTCACTTTTCTGAGCAAAAGAAAGTCCCGAGGTGCAAAAGAAGTCAAC
TTTTCTGTGGGTGATTATGTCCTAAGATCACGTGTCGATAAGCGACGACACAACAGGTTGCTAGTCACCTGGATCGGTCCCTACGTAGTTACCCGTGCGG
ACTCTCATTCGTTTCGTATTCGGCACCTCGTTACCGACAAGGAGCA