Description :
From Genome Similarity Track
Location :
Scaffold_1731:1464- 3009
Sequence
1545 bases(100 bases per row)
ACGTCACTTTTATGCATAAACATTCACTTCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCC
TCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGA
GACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTT
CGTCATATCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTC
GTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACTTCGTCGAAGTCGACGCGGTCGGATGCATCTACCGAAAGACGGATCTGCGGCCGA
TCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTCACCGCATGTTCTCCAA
TCTTCTCTCTCACCCGGAACGGTCCATGCCATAGATGGGCCATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATACAGCCACACCTGCGATCCCACT
TGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCATTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGT
ATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTACTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCC
ATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTTTGATCC
AAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCATCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTC
GCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAAAAC
ACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAACAATTCT
GTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATAGCTATGATCTGGAAAGGGTAAGTCGCTCGAACATTCCCAGGTGACTCCCCTTCGA
TCGTAGGTCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAATGGAAACATTCCCGGATCCG
TTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGC