Description :
From Genome Similarity Track
Location :
Scaffold_4:146379- 149740
Transcript NameFunction/comments
Phyca_LT1534100187ADP-ribosylation factor-like protein
Phyca_LT1534539823PREDICTED: dnaJ homolog subfamily C member 21-like

Sequence
3361 bases(100 bases per row)
taaagatggctacgctatttctcgcttcaaacaggtgacgctctctctcttcctccttggcagtattgagtgccaccaacaattggcgtcgatattttgc
aacatgagcgcacgacgactacgtgaagctaccaagacaacgccgaggagcatccccagtgcgtcattgtttcatgtgtgcatttcatcagactcacaaa
cgttttgctttacagatacaccacacaaagctgcggagagtgagcatgaatatcttcggcagtgtgtagaccccgtcttaatgccgctcatcgagtctct
gctgctctaccagcccgaaagcgtctatcacttcatccacgatttcgtagatgaacaaaaagccaatcgctttgcacaccgcacaaggagtgttggttac
gctaaaaagctcactaaccgccgaaagatggccgacttcatgtccaccagcgtgatccccgtcatggacgacctggccaaacagattctacgtgaaaaac
ccaattccgttaaaggtgagacttgaagagtgtggaatttccggttgattctaattcacctctttcaaaaagcttttatcagagacgtggttgcagcgcg
tatcgttatcgagtctgacgaagcgtccaaccaactcgaagattatgttcatttcagtgtgcatgatcgcgttctttgccgctataaaggccgtcctagg
ttctttccaggcatcatcaccgctgttgatgacgacggaagctttaccgtcttgtacgatgatggcaagacggagaacaatgtccattacatgtgtctaa
agctacattctccacatgaaaacgataataaagcagctacgcgaaacagaaagcccgaagacaatcaggaaataatcaagatcactcgaaaaatggcgat
tgtacttctgataattggcatcgacggagcagggaagaccacccttctatccacattacaaggtgatctggacaaagaacacgttccgagtgcaggcttc
acatccgccacgttcgagactgacgcagggtctgcaacattttacgaccttggaggaggcccgacattccgcaatgtgtggaaagaatactatgctgacg
taagtacttgtttaagtgggactactgcattgatactgacaaccaaatgctttaaacgtgcacaggttcatggtgttatctttgtagttgactcctcaaa
tgaaaatgcggttctacaagctgcaaatgtactcgaagaatcgatggcaaacgaactgatgattaacaagccgttgctaatgtaagtgcaagctgaaatt
tggtatttggagtaacgctttgacaaaaatgtgcagctttgccaacaaacgagaccaatccgacgcagtacaagagcaggaaatgcagcgtttgctgcgt
ctaaacaagtttccaagctccaagatcgccccctgcgtcgccaaaccagcagtcaatggtggcgttgtagatcaacgtcttgaagcaggacttcaatggc
ttttcgaccaagtccacaacaactttgacacactacaagaacgtgtcgagcgggatcttgcactgaagaagaagctggaccaggagagacgggagctaca
acgtgttcgtgtctcccgatggaaagaagagcgcgaactcaaccaaatgcaaatgcacgacaaaccttcagcggagggtcacagctcagcctcgaaagct
gtcgctgatagaccggaggaagccgtcatacagtgttcggagtgtagaactactccagcagtaacgaagtgcgcagcgtctaaatggatgcctgtgtgcg
agaactgcgcaacaacgttaagacgtcaatccacataaccttgtaattcaatactgcttcagcaaaccttcatttgcgtctatagggatcatgtcagtgt
cgtctatcttcgtttctttcctttcttgccacgaccacgctcttcttcttcttccttcttctctttcttagagcgtgcaccgctgacgatcttctctacg
ttctcctttttcttgttcttgcgcatctccttgcgctcccggcgtttctcagcagctttctgctccttttcaagccgcacacggtcagcttcggcttttt
gacgcgcgacctcctcatcagcttcttgctgctcggtatcaacattgtcttcgtctggtgtcttggcagttacttgaacttcctctatggcctcaacctt
taccttgccgagtgcgataagctcttcctgtagagctctatccatctcgtcatccaaaatgctgaggtcagtaaacacgccgagctcctcctctttatca
cggtgctttttcgaagtgaggtgattctgcaactgcttcgtggacttgaatgtcttgttacacaagtcgcacacaagcacgtccgcgtccattttctttc
gcaacttctcaagttcttgctcaatatctctgtcggcaacacgactggtttccaagttgctgtcagcccagagcttttcctgttgctcttgaaaggcacg
cttttcagcgtcgtacgcagcttgtttttcacgcttcttagcctcttcctctagacgtcgctgctccttctcctgctccttttgcttctggaaagctcgt
acgcgtgggtcacggcgatacacaaattccacgagctcgcgcacctccgtagtaaacgccttcttggcagcatctcgcagcttcttgttctctttttcca
tcgctcgcctcaccaatctcgtcggtgcatccgttgtcttgtactcatccacccacgcaaagctgcgctgcgacgtgtaacttttccagtgctggtagaa
atagttaacatcgtccatcgtcgagttggcacctccaagttccggtgcaactccagcatttgaaccatcaccgccatctagatccagtccgtcgatctgt
ttcgcacaaataatagttagcgcaatatatcaaactgtcacttgttcaacagccagctaaccttggtgaagagctctccatacaccgagtagaagctctt
ctcgtccgaaccgaagccagaatacaccgacgcactgaagtaccggaacaaattgagctcgtcctcatcctcatccgcgtcattgccgtctcctccgcgt
agaatctgctctctgtgctcatcgtaccatttcttctcatgcgggtcactcagcacctcgtaggcgttttgaattgtctggaactgctccgtggcctcct
cgctcgagatcccgttctgttggtgcttgtctgggtgccaccgcagcgcctgcagtcgaaaggccttcttgatctcgacagccgacgcatcccgcgcaac
agcgagcacttcatagtgacagcgcatttcgcccagccaaaatgtgtaaaagtggcgatgt