Description :
From Genome Similarity Track
Location :
scaffold_12:146342- 151438
Transcript NameFunction/comments
g778.t1 Poly(A) polymerase, putative
g779.t1 conserved hypothetical protein

Sequence
5096 bases(100 bases per row)
TGTAGTTTTGCTCAGATTATTTAATTTTTATTGTCTACAGGAAGATGACAGCCACCTCCTGCTTGTGTTTTCCTATCTATTCACCCCGTACCGTCAAAAA
GGCTTCGTCTGGAACGGTGACGGCCATCGCTGCAGTGTTTCATCTGGAAACGTCTTCGTCGCTGTCGTTCGCGCGAGCCTGGAAGCATGTATACAAACAC
ACATGAGGTCCCAACTTGCTGCTTGATCAGGAATCTTCCCACGCTCACCAGCTTCACCTCCGCAAGCTTTGTCCTGGTTGTCGTGAAGCACCCGCAAATC
CTCACTGCTACCTCTACTATTTTTTTTTCTTTTGTGGGAACAATGTTCTCTTTTTTCATGGCATCATTTTCCTCTTTTTTTTGCCACACGCCATCACTGG
AACCTCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTCTTGCGCGGCGACGACACGGCTGGGGGAGCCGTCGCCAACTCCAAGGGCTTCTT
CACCACCTTTGCGGGTGGCGAAGTAATCCCCCGAGCTTCCGCACCATTTGTCGACGTATTGGCAGAATTGTGAACACCAGCCAACGGTTTCCCTTCCGGG
CTACCAGCTTCGCCCACAGACTTACCGTCACGGTCACGCTTACCTGTCTTTTCTGGAGACGCTGTCGACACCACTTCCTTGGTCTTGAGTGGGGTTTTGT
TTACGGAATCAGTACCATTCGCTTCGCCACCATCAACTGCCGGATCGGGACTTCCAGGCTGTGAAATACTGCCCTTGCCGTTTGCCATCTCAGTTGCGAG
TGCTTCTGTCTTCTGACTGCAGGTCACCTCGTCACCATCTTCTTGTGAGTGCATGCCCTCGTCACCAGAAGGCGGGGGACTCGGAGCGGCAGCCTCCTCA
GCCTTCTTCTCCTCTTCCTTCTTCTTCTTCATAAACTCACGACGAGCAACACGCGCCACAGCTCGTCCACCCATGTCTTCAAACACACTATCCGGTAACG
ATTTCCACACGACTGAAGTCACTCGCACATCCATAGTTGGCGTTCGCTTGTTCCAGCGGTAAAGATCGTTGTTTTTGAAGTACTCCACTGAATTATCAAT
GCTCACTTCACGGCTGCGCAGCTGGCGCCGGTCAATGTCGAAGCCCACATAAAAACAGGCACCAAACTTGCTGGGCTGGGCAGGGGGCTGTCCATTTGAC
TGTTCTCCCGTCGGAGCCTCTCCCCCGGTCACGTAACTGAGTGGGAACTTCTTCGTACACACACGCAGGCGGCACAGCGCCTGGTTGTAGGCCAACGACT
CCACCAATTTTCGCATACGAGACTCGCAAAAACTGCACCATGCTTGCTCTTCATCCTCCTTCTCCGTGTACACCTCGACTGCAAGATAGTGCTGGTGAAC
AGCGAAAAACTCAGAAGGCTCGAACAATGGCCCCCATTCCGATCCACCCTTGCTGAGGACGTCCTGCACAATGGCCAAACCACGCTTAAACTCCTCCTTC
ATGACCGAGAGACTGTGTGTCGACACATTAAACGAAGAGTTCATCGACGGGTACGCTGGCGTCAGGATCGGCATCACTTGGTAGCTAAAAATCACCAGCA
ACAGTCATCAGTAACACGCAACTAGAAGAAAACCATTAAAACAACAATCACCTCACCGGTTGTGACCAGCATTAGCGTTCCAAACCTCCAGGCCGAGGTT
GGCATCCTGTGTCTTGCAGAGCTGAATGGCAAGTGGCCACTTCCAGTTGTTCAGCACCATAAAAAAGCGCAGCAACAGGGTCGACGGTGCCGCTGTGGGG
TACAACTGGTTGATGAAGCAGACCAAGATGCACCAATTGACACCACCTAGATATCCCATCTTGTTCGAGTACAGTCCGCGTCTCTTCGCCCATCTTCTGA
CGATCCGCAGCACACTGATGAAGCTCTCTCGGTTCGGCGTCAACTTGATCATCAACTCGGTCACTCGAGGACCATTGAGACTCTTTTCTGTAGCTGGATC
CACTCCAACCAGCACGTGGTCGTCCAGAATATTCAGGTTTTCAGGGATGGAGTTCCTGGGCAAGATGGCAATCTGCAGATCGATGTTGATCTCTTCGTAG
TCGAAAGTAATCAAGGGCACGATGGCTCCTTCAATAGCCACAAGGTGCGAAACTTTAGGATGTTTCAGGAAAATCTCTTTCAGTGAAGAGAAGAAATCTT
CACGCGTGACGTGTCGAGGCGCCACGCAGATAGTATCAATATCTGCGCCAGGTTCATTGACTCCGAGCCGGTACGAGCCAGAGACGAGGATCTGGCCGCC
AGCATCGGCCGCCATCTCCTCTGGTACGCCCTTCTGCATGCAGACCTGCTTGACCCACGCCCGGAAGATGGAGCGCAACTCCGCCAGAATCAGAGAGCGG
CGCGTGATATTGACGTCTGATTCCGTGGGAAAGTGCTCGTCCATGAAGCTCTGCAGCTTGGCCGACTGCTCCAGGTCCTTCGGCTCGGGCGGCGTCGTCC
GGATGGCCTTGTACGCCTGCTCCAGCACGTGCGGCGCCACTGTAAACGTCGCGCTCTGCATGGCAAGTGGTTTCAGCCGGCTCGTTCCTTTCTGCTTGTG
TCGACCGAGGTTGAATGGCGCTGTCTCTGTGCCGTTCATTGGCTGAAAAGGGATAAAAGTATCATTGGACGAAAGGAAAAAGAAGTTTTTACCAATAAAC
GTGAAGTTCGTTTTAAATTTTGAAACGTTCACAAATCTTCGCGGTGGAAATGGACGACATCGAGGTGCTGATGCCCCGCACCAAGTACGTTGCCCTTAGG
CTGCATACAGAGGAGATGTGCACTGACGTACATTCACTTGATTCTGTATAGGGCGGCTAACGACCGCGCGCAGGTTGACCGAGCTAAGCTGAAGCAGTAT
ATGGCCACGAAGAACACGCCGCACAGTGTTGGAGCGTAAGAAATCACATTTTTTTTGTATTTACGCGTAAAATATCTACTAACTGTTTTTTAACTTTTTT
TAGACGCTCGGGTGTTGTAGTGCGCGGAGACGTACGCAAGGATGCAGAGGGGTTCGAAGACGTCGACGACTTCTGGGTCGATGAGGAGGATTCTATGCAG
GACGATTCAGTGGACGACGACGACTGTGCGTACTAGTAGCTGCTGTACAATTAGAGACAATCATGCTAATGTTGCCTTGATTCTGCCGAAATGACAGCGC
TGACAGCGTCGGATAAGGAGGCAGCAGACACGTCAGGGGACATTTCGGAGCCGAGCGAGCATGAGGTGGAGCTGCCAGATATTGGCAGTCCGTCTATGAG
TGACAGAGAGAGTATGGACATTGAGACGGGTCCGATCCCGTCACGATCGGTGGCTCGCTCACAGAGAAGCAGTGGTCCAGTGGTGAGAGAGGAGAAGACA
GCAGAGGCGCCACCTTCGCCTGCACGGAGTGACGTATCATTTGATTTCGGTGGCTCGCCGCATGGATCTGTGGATATGAACGCTGAATCCAACGTAACGA
TGCGTGATCGTCGCAAGAAGTCAACTGGAAATGACACAGTGAAGTCCAAAACTCGTCGGCGAGAGTCGTTTGGATTTGACGACGATATGGCTAGTCCGTT
CTCCATGAATGAAGGACCAGTGACGCCGCTGTCGAACGGTACGTACTTCACACTAGTTGCTGTTGACTGTTGGGTGAACTGACGTGTTGTAATTGATTTT
CAACTACAGCCAGCGACCGCACGTTGAAGTCGATCCCGTCTTACAAGAGCTCGCTCTCGCCTAACATCAGCAAGGAGCTGTTCAAGGAGGGTGACTATGG
TAGCGATGCTAGTGCTGAAAAGCCTAAAAAGAAGCCAGGAAAGGGAAAAGCAGCGAAGAAGAAATCAACTCGTGGAAAACAGTCGACTGGAGATGCCAAG
ACGCGTCGGATCCGACCGACAGGCAACTATGGTTATCGAACGAATCCACCTGAGACCGACACCTCCATCCAGTCCATCCATACGGACGATGATAAGGATG
AATCCTTCGAAGCACAGAACGACTCTGGCGGCGAGACTGGAGACGACAGCTTTTACAACGAGCCTGACGCCCCAACTGGACGTGTCCGTGACAGATTGCC
GGACGCCTCAAGGATTCTGGATGGCGACGAAAACGATGACGCTTGGGATGGCAGTGGCTTACGTCGATCGAAGCGGAGACGTTTCAAACCACTTGCCTGG
TTCAAGAGTGAGCACATGGTGTACGAACGTACTTTCGTTGGCGTGGGCACAGTAATGCCTACGGTTGTGGGTGTGGAGCGTCTTGGTTATGACTCCCCAA
CGTCGAGCAAGCGCACGAAGGCCAAACCTCCGTCGAAAAGGACAAACAACAGCAGAGCATTGGCTTTGAAGGATTTGCCTAAGGACGTGCAGAAGCGCAT
CGTGGAGAGCGAATGGGCGACGCTATACGACAGCCAAGCAGGTTGTATGAACGATCTGAACATTATCTGCCGCTCCAGCGAGATTCGTCTACGAAAGCTC
CCGACCGAGGAGAGAGGTGGTGCAGTAGTTCACGCGTATGCAGGCCAGAGTTTCAACCTCTTCAGTCCGTCTCCGTTTGCTCGGTGGATTTCAGGTCGTG
TCGTGTTGCCCCCAGGCGCGTGGAAGGAACCTGAGGGCGTAGGTCAAGCCGTGCAGTTGTTCTACGTGACTGGATGTCAGCCGAAGTCGCTCGAGTTGGC
GCTGGCTCCTGAGACAGACGATGACTTCTTCGCTAGTAAGCACACGACTCACTTCTTGCTCAGTCCGGGCGATGAGTTCTACGTGCCGTCCGGTAATGTG
TACTACGTGAAGAACCACTCGAGCTCTGCAGACTGCGACTTGCGATTTACAATTCTGAAGCCTGAAGCTCCAGCAATGGTGGACGATGCCGACGCAGAGG
AGAAGGAAGAGCCAACGACTGAGCAGCCGCAAGAAGTTGAAGCAGAAAGCAGCCCACTCAAACGCAAGCGTGAAGACGGCGCGGAAGCTGATGCAGACAG
GGATTCAGACTCCGTCTAGGGTGCCGTACTCCTTCTCATGTTTTACTGTAACAGCAATTAATAACCATTTTGCCATTCTCTACAATTGATTCTTGT