Description :
From Genome Similarity Track
Location :
Scaffold_55:146320- 148079
Transcript NameFunction/comments
Phyci_228149Hypothetical protein

Sequence
1759 bases(100 bases per row)
CACGCCCAGCGCCTCGTCCTCGTACTTCATCGAGGGCCCGTGGGAGCAGCGCAACCGCCGCTTCCagaacgtgctgctgcacgtgtgcagcttcatcctg
atcctcgagttcgccgagcgcgtgagctactacggcatcaaccagggcctcaagaacttcatgggcaagctcggctggtcgcaggtgggctccaactccc
tcaagagcacgtggacctccatctgctacctgtcgccgctgctgggcggctacgtggcggacgagaagtggggccgcttccgcacgctctgggtcttcgg
ggtctggtacacgctcggcgccttcctgctcacggtctcggcgcacccgaagctcatggagcccgagcacgacaaccacatcgccgccaacgtgctgtgc
cacatcggcctgttctgcggcgtggccgtgggcacgggcgccatcaaggccaacgtcatcacgttcggcgccgaccagttcgacccgaacgaccccaacg
aggtcacgcagaaggagcacttcttcagctacttttacatcgtcatcaacctcggcgccatcttctcgtacggctacctctcggtgctgtgcgtggaagg
cacgggcgccatcacgaaggactacggctacttcgccTGCTTTTTGATATGTGGGGCAGTCATGGTCTTTGCCTACGTGCTGTTCCTCTTCGGCTCGCCC
AGGTACGTGCACTTCGCACCGCAGGACAGTGCGCTCACCAAGCTCTGCACCATTGTGCTGGGCAACTGCGCCTTCAGCTACGAGGCCAGGATGCTGTACT
ACGGCCTCATCGCGTTCGGGGCGGCTTTCCCGCTGAACTTGCTGGCGTCCTTCTTGTCGGACTGGCTGTCGGTGGGCCAGTACTTGTCGTACTTGGTGGT
GCTCTGCTGCGCCTTCGGCATGTACGCGTGGATCCGCTACGGCATGAACACGGCCTACATGGACAAGTCCAAGGCGTCGAACGGTGGCAAGTTTAACGAC
GAGACTGTGGACGAGATCAAGATGGTGATTCGGGTGCTCCCCTTCGCGTCGTTCATGATTATGTGGGAATGCGCGTACGACCAGCTGGACGCCAACTTCC
AGTCCATCGCTCAACAGTGCGACCTGCGAGTTGGCGCAGACAACATCAGCGATTATGACGCGATGCAGATTCCTGGTGCTAGTCTAGGTATTTTCGACCC
GCTCACGATCATCTTGCTGATTCCCCTGCTGGACGGCTTCGTGTACCCGTTGTGGGGAAGGATCTTCGGGCGACCACCAAGTGCTTTCGGTAAAGTGCTG
ACGGGGCTTATCGTGGCGATGCTGACGATGGTCTGGTCTGGGTTCTTCGAGATCATCCGGCGAAACAGTGGCGAGATCGTGTACCTGGACGAAAACGGCA
CGCTGCAGACCATTCCGAACAATGGGTCGAACCAGCCGATGAACCACACGTACTGGGCATACGCAATCCCGATGTATGTGCTCATTGCTGTGGCCGAATG
CCTGATCAACGTGACAGCCTACGAGCTGTTCTACACAGAGGTGCCTGTGTATCTTAAGAGCACATGTCAGGCTATCAATCTGTTCATGGTTGCCATGGGA
AGTAATCTGACGTCAACATtcacgctgctcttcgagcactacatcacggacaatctcaacgacggacatttcgagtacatgtactggacgctcggcgcgc
tcagtctaatcaacattatcgcctacgtGACGGTCATGAAGTGGATGGAGTTTGGAATG