Description :
From Genome Similarity Track
Location :
Scaffold_3:1463046- 1464918
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01620hypothetical protein
Phypa_INRA-310PPTG_01621hypothetical protein

Sequence
1872 bases(100 bases per row)
GCGAGCACTGGATGATCTCCCTCTTAAGTCCGCACTTGGCGCTCTGCACGTCAATCTCCTTCTCTGTCTCGTCGTCGTAGCCGAAGCTCGAGCACATGAG
GAACACGCCGCCGGGGGACAGCAACCTGTCCACCGTCCAGAAGAGCAGTGGCACTACCTCGCGAGCATAGATGACGTCTGAGCCGACGATAAGCTCCGTG
ATGCGGTTGCTACCCACCGGCCCAGCCTGTAGTTTCTCTAGCGCCTCGATCTCCTTTGCGCCGTCTGGTCCCCAGCGCAGACTCTGCGTGAGGCATGTGG
CCTGCGCACGCTCCTGCTGGCCGGCATTGTGCTCGATGACCTTGAGCACACCGGGATCGTGGTCTGTGAAGATCACGGTGGCTTCGGGTCGCAGCTGGGC
TACAGCCAGACCCGTGAGCCCGCAGCCAGCGCCCAGTTCTACCACGTTGCCGTTCGGAATAATGTCGCGGTGTTTGGTCAAGTACTCGCAGAGCGCGGGC
GCCGCGGGCCACACGTAGTGACCGCTCTGCAGTGCGCCGGGCTCCTCCTTGGCGTACGTGAGCAGCACCGACACGTCGGCGTTGGCTCCGTACTCGTAAC
GGCATGTGACCTTCTCGAGACATGCGTCAAACATGAAGCCCACGTCCGTGAGCATTCCTTCCGTGCCGGCCTCCATGTCGATCGACTCCATCGCTTTGAA
AATGAACCGTGAACGTAAAAATGAATGTGACCGCCAGTCACTCACTGCATAGGAGCAGCGATTACGTAGTGGAAGTCAAATCGCAGCCTTTAGATCAAAA
CCTGCGTATCGTCATAAAATGGATTTGTCATCTTTTGGATCGCACGCAGAATAGTTGTCGCGTTCAAAGCGCTGAGCCATCAGAATGATTATTGGTGATA
TGCAATTGACAAAAAGCCCCCGACTATCCTATCTGCGGGTGTGCAGGTCGTTGAGTGTGATGATACTTGTATTGCCATCACAACAGAGTCATCTTGGAGT
CACGAAAACCCTTTGATGGAGTCCGTTCACGTTCGTATCTAAACTACAACAATGTGCATCGGACAACAAACATTTTTACACACATATCGGTGGAAATGCG
AGTGGTGTAGCTTTTAACTCTTTTGTTATGAAACAAGCGTGGAAGTTCTGCTGCAATTGCTGGCTGCAACTGCTTAGTACAAGTGATGATCATCTATATG
TGTTTAGATAGGTTATTGAAGTCCACCACACCATCTATTTTTGGCGGGAAGTCCAAATTCAGAAAGGTCAATTATTGCTCACTTCTTGCAATGAGCTACC
CACTGATGCGGCGTTTGCCGCTGGTCGCACTAGACCGACAAGTGGCGCGTGCGGGTATGCAGATCTGCCATAAGATCGTCATGCAGCAGCTCTACGTATC
GCGTGCAGATTCAACGAAGCAGTGGGTCGTGGTGTCCAATCCATCAGAGCAGAGCGTGGACATGACAGGCTTCAGCTTGAGTTGCAGCGGCAGCAGCGAC
GTTTTCCACTTCCCAGCCAAGTACACACTATTACCAGGTGACGAAGTGACTGTCTGGTGCTCTCCAGGTGGTCTCAAGCTCGATGTGGACAATCTCCTGC
AGCCCTATCTCTTCTGGACCAAAGCCGACGGATCTCTGCGTCATGAACCATTCTTCTCTGCAGCTCAAGCCAATGAGGTGTTGCTATTAGACCCGCTATT
GATTGAAGTAGCGTCCATTCGAGTGAATGGAGACGGCAAGAAGGAGTTCCGCGTGTTACACTGCAAGTCTGCACACTCCAGGACTTTGCGCAGCGAGATT
GACACGCGATTCTGTGTCGGATGTCTGTCACCTCCTGAGTTCGAGAGACGTACATCACGGCCAACTCCCGAG