Description :
From Genome Similarity Track
Location :
Scaffold_730:1463- 6285
Sequence
4822 bases(100 bases per row)
GCAGCCACGATCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTGCTAAT
CAGTGACACGGGATATATCATTCATCTTGTCAATTGGTTCACTTTCCTGTGATCAATGCATAGTCGTATATCTTCCCCATTTTTCTTGATCACCACGATA
GGGGAAGCCCAAGGTGAGGTGGATGGCTGGATGATCTTGGCCGATAGTAGTCCCTTAAATTAGATCTGCCAGTTTCTCTCGATATTTGGGTGCCTCTGGT
CGTACAATCTGCGCGATAGGTTTTGCACTTCCGACATCAATATCGCATACCGCTCCCCACGCAGCTCAAGGCAGGGCATTCCTTTTGTCTATGAGGGAAA
GGCGATTCTTCCAGATTAGTTGCTTTAACTTTTTTTGATCATCTGTCAGTGGTATACCTGGATCGCCAACTTGGATGTCTTTGATAGCCACATCTACCGT
AGGAACGACTACTTCTGGTAAGATCGACATATGTTGTTCCACGTCTTCGGCGAGCAGGTCACCCGTATCATGGCGATATACCACAGTTTTCGTCGAAGTT
TATCTACTGAATCGTCTTCGATAGTGGGCGTTGTAGCGCTTTTACTCCCTTGATCTGACGATTTTATCTCCTGATCGCCCACATTCCGGCAATCATCCTC
GGTCGCGACCGCCTTTTCTTGTCCGATCGCCTCATCCAACCAGTCCTATGTCGGATCGCCATCCCCTACTTTTGCAATCATACTGACCGCAGTAAGCGTT
CCTAACTATTTCTGTTCTTCACTGGAAGGGTGGTCTTCATACTCGATATTGACTCATTTTTCGCGTTCTGTAATATCTGACACTCCTGCTTGTGACACGA
CCTTCCCCTATCGGCTTACATCCGTTTCCCTTTCATGTTTCTTTCTGTGCATCAAAATATTTTTTGGGATTGGGCACGAAAGGTGGTCCACTAAAGGCTC
CGAATACTCGATCGGATTTTCTTTGATTAACTCCGTTGTAGCTTCGAATGCCAGAGTCTGCCATTCATTATACCGGCGTGATCCGACTGAAACGTACCCC
GGTGATCAAGGTATCATGTCCGCCATCCATCACCACCCTAGGGGCATATAGTGATCGAGAATCACCGGCTGATCGACGATATTGGTCAGTACAAATACTA
GATCTGGCCGGGGCTAGTAGTAACCGTCGGTACCCCATTTTTTGTCCCACCTTACCCATAATTTGGATTTAGGGAAACCTGCTCCAATCTTCAGTTCCGT
GAAGCCTCCTACTGGGATTACCACATGTTGACTTGGGGCAGTGATCGGCTGTATTTTTACTCCATATGGAGGTCGTCGCCCTGCCAGGTGAATTTCCACT
TCTTCTGGCAAACAAAGCGTACCGTTTGCTAGATCCAAACGTATCCCTGCTGGCACCATAAAATCCATACCTAAGATTGCTTCTTGGCCAACTTGATCGC
CCACCCAAACATTAAAATAGTATACTAGCTATCCGTTTAGCGTGATCTAGATCTTGGTGCGCCACTCAGTCATGTAGACGTTCTCCCCGATTCCCACACA
TTCTTGCTTCTGGCTTTCGTTGATCATACACCCCACCTTACGAGCAAAAGTAGCGTCGACGATTGAGACCTCGGCTCCAGAATCGAATTTCATAGTGGCC
CTTTCGCTGTTAATTTTACCCACCGCTTTAGCTTGTTTAAGCACTTTCCCGGTATGTAATACTTCCAATATTCTCGCGACTCTCCCGGCGCTTGATCGAG
CTCCATCTTAACGGGAGATCGCGACTATTCATCCACCCTCTTCACACTTGAAACACTACGCAAACGATGGGTATCCAAATCACATGTATTAACTATCGGG
TCGATCCGATTGTTACTCCCCTGATCGATTATAAACATCTCCTCAAATGCATATATGTATAACCTTGAATGCTCGGATCGTACCAGATTCCAACCTGGCG
AGCGTCCTAGTTTAACATCCCCTCCACCTTGGTCGGGAGGATCCCCGCGTGCTTGGTCGGCATGTACCACTTACGGATCAGGTTATAGTACTCCATGGAG
AATTGACCGCTATCATGAACCTCCCCACACGCGGGACACGAATGTAGGCATTTATCCGAGGGATGTCCTTTGCGGCCACACTTTTGACAGGTCCATCGTT
TCCAACATCCGCGATCATCATGTCTTTTTGAGCCGCAGTGTGTGCAGGCTTTCGACAGTCCGACGCAATCGCGATCATCGTCCGATCTGTCTTTCGCGAT
CTGTCTCGTTTCTCTCCCAGATCTGCGACTTGATCGGAGGCGGTCGTCACACCGATCTTTGCGCCGAAACGCTTCTTAAAATATTTATTGATTTACGAAA
ATTTATTTATCTTCATCCGATCCATCCGAGCTTGAGTCCAAGTCACTCTCTTCACTTTCTACGCGAATGGCTTTCAATGCGCGGGTTGTTTTTGAATACA
CCGGAGCCGACGCTTTAGCCGATCGCAATCGAAATTTGTTTGATTCGGCCGACTCTTTATTCTATCAAAAGTCCATACACTGATACGCGTGTAAAGCTTC
TTCCGTCTGATAGCGTCATGTCTCGCAATATTGTCGGATGTTTCGCCAGCTCTCGCTCGTCCAAAGTATCAATGAAATGCTTCACATGCTCACGTCGGCA
TGGTGGCGGATCATCTCTGAACGACACTTTAGCTCGCATTCCTGCCACATTCAGCAGGTGGAGATATTCCAACGGGGTCTCATTCGATCGCTTCCACGCA
TGGTAATATTGCCTTCCTGCTGACATTCCGTATCATCCGTATTGGACCATGAAACTTTCTGCCAATGGTTTCCACTCATTACGGGTCGATTGGCTCAACT
GGTTGTACCATGTACCAATTTCGCGCAGGTCCTGTCAGCAGACCTCCAAATACCAAATATTTTCCTTATCGGGAGCTTGATCACGTAGATGGCTGTCTTC
ATCTTGATAATCCTGCTCCTGG