Description :
From Genome Similarity Track
Location :
Scaffold_553:1463- 4466
Sequence
3003 bases(100 bases per row)
GACGTCGAAATGGAATCGGTTGGATCGCGCGAATACGACCTGGACGACCTGGATCTGGTGGAATCCCAGCGAGGATGGCCAATGCCGCAATGGGAAAGGT
ACTCAACATGATCCCTCGCATCAAGCCTTCTGCAACTTCGGACCTCAAAGAGTTCAATGGTCGATACCTAGACAAGGACGGGGCACGCAGTTGGGTGACG
ACAGTGAAGACGGCCTTCGCAAGGGCCTAAGCACCGGAAAGCGAAAAGTGTCTTGTCTTTGAAGGGCTGCTGATCGGACCGGCGCAGAACTGGTATCGTC
ATTGGGCCGCTTCGTTAGAGAATATTGGAAGGACTTGCTACAAGAAATCCAGATGCAGTTCTGTGGCCTGTGGGTACCAGTTGCCCGCCAGCACTACCAC
GCGAAGAAGAGGTCAGACGAATCCCCGTATGACTACCGATACCGCCTGAACGTGGTTGCTCGCAGGGAGAAGATGGAGATCAAGAATGTATCACCCAAGA
TCCAGAAGGAACATATCGAGCATTACATCGAGACCGTGGACGACCTAGAGTTGCCAAAAAAACTGACGATGCTACGTCTGTCAGAATGGAAGAGCTGAAG
GAAGTATTGAAGGCGCACCACAAGTCGAAGACACGGCGTGGCAAGACGCTTTTTGATTCCAGCAAGTTCTGGTAGAAGGTGTCAGCTCCTCCGGATCGAC
CTAGATATATAAACCGCCGTTCTGCATGTGGTCCAAGCAACCCTAGAAAAGTCGAGTTCGGAGAGATCCAGCCTGGATAATTCGGATAGCGAGGGAGGCC
GGAGGTGAATTTTTTTTAGCGGAAGCGGAAAGAAACCAAAATACAAGGACCATGAGATACCAAGCCACCAGAGAGGTCGACCAGCATCGGAAACAAGTGG
AATACCCTGGAATCCGCAATAGGTCGGCCAAATTAAACGTAAGATGTACCCACTGTGGTCCAGGAAACATGGAGACTTGAGGTGCTGGAAGAGAATGACC
TGTGACCACTAGGGGAAGAAGGGGCACCCATCAGATCGCTGCTTGCTCGTGTGTCGGGGATGTGGAGAGACCCATGTAGTGGGGAAGTGCCAGCTAAAGG
ACTTCTACAAATTGATTCTATAATAGTACAGCCCCACCAAGCACGACGGAATGTTGCCGGGGAAAGTTGAGAAGATGATAAATTGGAATACTCCAGGTTT
GAATCTGGTACGAGTCGACCGTTCTAGTTTTTGTGTCTTTGCATATTTGGAAAGCAGCCAAAAAGGGGAGAGGGGGTTTACCACTGAGAAGACCGAAAAT
ATATCGAAGATTGGAAACTATCCCATGGACCATGTTGTCTCTCTCACTGAACCTATGATTTCGATCAAGAAAATGCAGTGACGGAGTTAGAACTACTACC
TGGCGATTTCAGAGGGTACCGTGCCCCCACTATGTTATATAAACAAGCCAAACTCTCTGTGAAGACTATCAACGATCGCGCAATTTTTTGTTTAATACTG
GCGCCGTGATATCCATTTTAAATGTCGCCTGTGCTCGTAAGGTAGGCTGCCAAATTGACAAAAGCGAAGGGCAAAATTGCATTGGCTTTGGGGAATCGGT
GTACTCTACGTAAGGGCACCGTCGCATCAAGGTCACCCTAAGCGTCAATTTAGTGTACATTATCAAGGTGTGGATAGGCCCTATGGTGGGTCAGGATGAG
ATCTTAGGAATGGACTTCATGGTACCGGCTGGTATCCCGATAGATCTGGCGGATGGAACACTTTGTCTCCCTGACGAAGTCCGAACATAACTCTCCGGAC
AGAGGGCCGTTTATGATAACCGAGTCCCAGACGTGAAGTTAGGACAATATGCCCGTATACTTGCTGGTGGATGTGTGGAGATACCTCTTGAAAAGTCGAT
ATCAGATCAATGGAAGATATGGTTCACAAGGGGAGAGCGATTGATTACAACTATGATCCAGAGAACAGGACGCTGACAATTACTATATGTGACCAACGTC
AGCCCCACACGTTGATATTACATAATGATACCATGATAGGTATGTGGCTTACGAAGGGTCAAGTACCAAGAGCACAAGGGTTCGTCTATAGGCTCTCGAA
GGTACGCTGAGTGGCGAATCTGGCGTACGAAGCCCCCACCGACCAGGTCGACCCCAAGTTGACCTCGAGTAGGAAGACGAGGCACCACTAGTGGAGACCC
CGAAGTACAAGATCCCGTTGCATAGTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGAGGCATCACTAGTGAAGACATCGATGTTCAAGAGACCTATGCATAGTTTGCAGCGTTAGAAGCCGGCAGGATCAGTGAGGACTCTGTCATA
TCAGCCGATATCAGAGAGAAATTAGACATTCACGTGGAGAAGAGATGCCTCAACGAGAAGAAACAGCTCAGAGAAAGAAGTGGTCCCAAAGTCAATCCAC
CGGTAGAGGTTGTACTAGAAGAAGAGGAAGCCGAGGCCAAGGTATTGCCACGGGACGATGAATAAGTGTGTACATTCCATAGTGGAGCCCTGAGGGCCAA
AGACATAAACCGAGGGTGGACAATCATACCGGAAGTGGACCTCCTCTGAAACTATCCGGTTAAAAGCCATACAGATTCCTGATCCGGATGGGAACACTCC
AGAAGAGGTAGACCGGCTACGACAAATCATCTGGAAAAGACGACATCTGTTGATGGGGAAAGGGAAAGCCTAACCGCCAGCCGCTCGAGGGGCTATATGT
GACAATGATGTAGTAAATGTAAAGCGGATCGCGCAACGTGTACGGAAAGTGGCCCCTCAATTTTAAGAGCAGTTGAACGACCTGATCAAGGAGCTGCTAT
CTG