Description :
From Genome Similarity Track
Location :
Scaffold_1416:1463- 2619
Transcript NameFunction/comments
Phyta_totarag12927hypothetical protein PHYSODRAFT_346539

Sequence
1156 bases(100 bases per row)
ACCATTCCTCCTGATCTGGGACCTCCTCGCAGACCCTCTACCCAACCACTCACAAAGTGGCCAGATCACTTCATGATCTTGTTGCCTTATTGCTTCTCGT
GCGACTGCATGGCCTCAAACCGGTTCCGGTTGACCTGCTCGCGCAGGTAGTCGTGCAATACAGCTCCACAGTTGAGATCGGCTTCATCCACCCATGCTGG
TTCAGGGTAGCCCTTCCAGTGCACCAGAAATTCCCATAACGCTCATCCGTAATGTGTTCGCCGTCCAGGTGATGCGTTCGACCTCGTActcgtcatcatc
aagcTCCGTTTCCCAGCTATCATCAGGCAGCAAGGCTTCATCAAAATCGAGTCGATCTCGATCTTTGACAGCTAGCCGAAGACGTGGGCGGTCAGGGAAA
TCTCACATGAGCTTAAGCTTCGACACGTGGATCACGGGAAATATGTTATACGTCGTGCCCGCGATCTCCAGTCGTATGGCGTgttcgtcgatcttctcga
ccACTCTGAATGGTCCGTGCGACATGTGCGCTAACTTCCGTGTGTAGACCTCCTTCACTCTGTTCAGGTATAGACAAACCTGGCTGCCGACTTCGATCTC
GTGCGGACGCACGGAATCGTTATGGCGAGCNCCCAATCCTTCTGGTCGACATCTGCGACGTACATCTTCAGTGCTCGCGTTAGCGTTTGCACCATCCGTT
CAGCCGTACCGTTCGCTTGCGGCCGATACGCCATAGTTGCTCGTTGCCATTGTCCGATGATCTTGTTGAACGAACTAAAAAGTCAGACATGAAGCCTGGC
TCTCGATCGTGCCGGATTGCTTCACTTGCACCAAATCGTCGGAAAACACACTCTTCGTAATTCTCCGCAATCGTTTGAGCAGTTCTTGATGCACTGCCTT
GGCGATCACGAAGCCGGTGAAGAGATCGACCCAGATCAACAATTTCGTGCTGCCCTTATAAGATCGGGGCAGCGACGGGATGTTGGTCCATAGCAATGAT
CTGAAATGGGTACGTCGCTTGCAGGTAGCCTGGCGACTCACCTCGAACAGTTGGTCTCCCTTTTCCAGTCTCGCAGTCTATGCGCTGATCCACGTAACGT
TGCACATCTTGATACAGTCCCCTCCAGTGGAAATGTGCTTTGATTCGCTGGTACGT