Description :
From Genome Similarity Track
Location :
contig_55:146296- 147751
Sequence
1455 bases(100 bases per row)
GCACTCCTCGCTGTATCCTCCCGGATCCGACATGGTGTCTCTGACGTGTCCCAGTATCTCGGGCACTCCCAGTTCCAGCACTCCGACACGTCCCAGTACT
CCGACGCGTCCCAGTACTGCGGGCACTCCCAGTTCCAGCACCGTCGGGGCTTCTACGTCATCTGCCAGCGCTACTTCTCCGGATCGCGCACCAGCAGCTG
AGACTCGTTCTCCGGTAGTGCCGACTCTCCCAATCGCTCTCCCGCACGGTGATCGCGGGGCGGCCCGCAATCTCCTGGACACCTTCGCGGACCTGTTAGC
TCGCGCCGATGCTCAGTCCAGCCTGGAGGAAGATCATGCAAACCTCCAGCGCGCGTATGTTGCTCAAAGGGAGCGGGCTGATCGCCTGGAGCGCGAAATC
GATGCGGCGTATGTCAACGCGTCCCCTTACGTCTTGTTCTGCCAACGCCAATACGACATCCTCTACCGCCGCTGTCAAGACGCGCAGCGACTGGCTGCAA
ACTTCGAATGTGTGGTGCGAGAGCGCCTTGACAATTCGCGCAAGATTGCTGCTATCCGTGACCGGCTGCGTCTCGAGCAGGACGTACACACGGAGGAAAT
CGCGCGTCTGCACACGGAAATAGACAGCTTATGTAGCGGGCTACACATTCGGTACACCGCCTACCTTAGTGCAACACGCACTAAGGAATACATTCAGGTG
ACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATTAGAGTCATTCAATAGATAGGGGTTCTGC
CAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCATTTTTAGGAGGAAACCGCATTTACAATCAATAGAGTTCTCATTTAGCACCAAAGCTATCGTT
CGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACTCCTACACTTTCTTATACACGTGCGCACACGTGTAA
GCTAAAGTAGTGGGTCTAAGCAGACCCATTACATTTTCTACGGCTTTACAGTAAACCTTAACGTCGCGATCGGAAACAGTGGAGCGGGGTAAGCGATGCA
GACGTTGGTAAAACTCACGAAATAGTACGACAGTTTCCTTGGTGGTCGCATTCGACGTCGTCGGTTGGAAATGAGCTCGTTTCGTAGGTCGGTCCACTAC
GACCAAAACTGCGTCAAAACCACTGTGCGTCTCGGGTAATTTCGTCATGAAATCGGCACTGATGTCTGTCCAACGTTGTTCTGGGATCCCGAGCGGATAA
AAGTGTCATGTTGGTTTTCCTCGGATTCACTTGTTGCGTTGACAGAGTTCGCAATTTTCTACGTAGGATCGCACTGACTTGGCCATACGTAGCCAATAAT
ATTTAGACGCCACAAGTGGTTGCGTTTTGGCCTGGCCAGGATGTCCGTGGGCTGG