Description :
From Genome Similarity Track
Location :
Scaffold_105:14629- 16158
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_105-snap-gene-0.21Erythrocyte binding protein

Sequence
1529 bases(100 bases per row)
AGCCAGGAGTGCCATATCTGCCTCGAAGAGCTCCGGCAGGACCTTGTTGCGTGCCCTTGCGGTCATGTGTTCCACCATGCGTGCATCCTGCAGGCACTGC
AGGTGAACACGCAGTGTCCGATCTGTCGGCGGTTTGCGGCAGAGTCGCATCTCATCAATCTCTATTTCGACGTACCCGGTGAAGCGCCGAGTCCGAGCAG
AGACCATCAACCGCATCATCAGCGGCATTCTGTTAGTTCCGGGGACGGCGTGGAAGATGGCGGAAATTCCGCAGAGCTGGCGCATATTCAGAAGCTGAAT
GAGCGCGTGAATGCGCTCGTGGAGCGACTGCAGTGGCAGAAGAAGCAGTACGACCTGCTGATTGCCGAGATGAAGCGCGTGCGGCACCAGAGCGAGCAGC
TCGTGATGGACAAGCAAGGACTCATGCAGCGCATCTCTGCGCTCGAGGCAAACAAGAGCGTCCTCGTGAACAAAGTGGCAAAGTACCAGATGGAGCTCAG
TCGACAGGCGGAAGCCGCGCGGCAGATGACGGTCAACCAGAGCATCATCAACTACTTGAACACGTGCGACTCGGAGGCGATGGAAGAGGAGATCCAGAAC
CCACGAGAGCTCATCATGGCGCTCAAGAAAGCATGTGCGTTTGATATTATGTGTGTGTGTGGCACATAGTTTGTCTGTTGTGGCTAATTGCTTACGTTAC
GTTGACTCTGGCGTATTCAGGTAAATTTCGCCACGACCAGTACCAGAAAGTCGTGAAAGACAAAATGCGATTAAAAGCCATGCTCCAGAACCACTCGCAG
CAGAGTGACGGGAAGAGCAAACTGAAAAGCAGTGGTGGCGGTGGGTTCGACAGCAGCAACAAGCGACATTATGCGATGGAGTTCAGTGGGAACCACAATA
CGCCGCCGCCGCCGCCGCCGCATCCACTGGAGCTGAAGAAGCGCAGGACCGATCCCACATCTCTCCATTCCGGTACCTCCATGTCAGCAGCAGCGCCGTC
GCCAGTAAACTCTTCTTCATCGTCGTCTGCGAACTTCACGCCACGATCCGAATCCGCGGGCTTCCGCGCGAATGCGTACTCGGACGTGTCCGTGCGTCCT
GTGACCACCGCAAGACCGACTTTCACAAGGAGCAGCTACAATCCGAACCAGTACGGCGCCTATAACATGACACCGGCGAACGAGCCGCCTGTGCAGACTT
CGAACCACGCAGTTTGCCGGAGGGGCTACGATGAGACGGGCAAACTAACGAACTTCTTCATGCCAAAGGACCCGAAGCGAGGCGGAGGCGGAGGGGCTAT
AGCTGGCGGCGCGCCGCAGCAAAAGATGATTCCAAGTATGCAACATTTACTGGGACTGCAGCAGCAGCAAAGCGTGCAGTCTGGCAGCGGGTCGCTTGCG
AATCAGCAGCGACCCGGANNNNNNNNNNNNNNGAGGAGGAGGAGGAGGAGATCGAAGAGAGTACGCGCTGACGAGCTGGCTGCGGAAAGAATCGTAAGAG
CCGCGACGAGGGTGACCGAGGGTGAGGAA