Description :
From Genome Similarity Track
Location :
Scaffold_92:14626- 21781
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_92-fgenesh-gene-0.5Voltage-gated Ion Channel (VIC) Superfamily

Sequence
7155 bases(100 bases per row)
GTTCCGCAACCGGAAACGATCAGGGTCCGCCGAGTTCCTCTTCACAGAAGTCCGCAATGCGTATGACCCGAGCTCGCGCTTCATTACGACTTGGCAGCAG
CTCATCCTCGTGTGCACCCTCTTCGAAATCATGCTCGTGCTGTACATGGCGACGTTCAACACCGACAGCGCACCGTCTCTCGCGCGGTTCGACCTTTTGG
GGATGTACATGTGCGAGCTTGTCTTCTGCGCGGACATCTACGTGCAGCTCAACACGGGCTACTACGAAGACGGCAACGTGCTGCGTGATACAAGAAAGTC
ACGTGTCAAGTACCTCAAGTCGACCGGTTTTGTGCTGGATCTACTCGCGTTACCACCACTCTCGCTTATGCCCGTACACATGCGTAGATCCGTCGCCTTT
CTCGAGTTCCACAAGTTCATCCGCGTCCGCCGACTGCCTCAGCTCATCTCAAACCTTGACAACATCTACGCGCGCTACTTCGTGCCGCTCAAGCTCATCA
AGGTGCTCGGGATCACTCTACTAGCGTCGCACTTTGTTGCGTGCGGACGATTCTCGTTCGGGTATGACACGCACCACCACGACCACTGGCTCCCGGAGGT
TCCAGAACACGAGCAAAGCGATCGCACCAAATATCTGATGTCTCTCTTTTGGGCATTTGGATTGCTGACTGGGCTGCTGGAAGGGGAGCTGCCGCACACA
AATGCAGAGTTCGCGTTTACGATCTTCGTGGGGCTCTGTGGATTCTCCATGTTCACGTACCTGTGCGCGACATTCTTCATGCTGTCGAAGTGCGAGAGTG
GCGACTCGGAGACAGCGGAAGCGCGCGTGAACCAGTTCAAGCACATTCTAGCCTTCCATCGTGTTCCAGAAAAGCTACAAGCGCAAGCTGTCGAGTACTT
GAAACGGTATTATACCCAGGCTGAGGCGAATGATCGTGAGGCTGCGAAGCTGCTGTGTCCGTCAATCTCCAGCGACATTCAAATCGAGTTGCTGCAGGAC
ACAGTCGCTCATATTCCAGTGTTCGAAGGCTGTGATACGCACTTTATCAAGGCTGTGACGAGTCTGCTGGAGTTGATTTCGTGCCCAGCTCATTTCGTGC
TCTTTCGAGCGGGTGACCACGGCGATGCCATGTACGTCGTGAACTCGGGTGTCCTCTACACGGTGGTGAATGGAATCAAAGTTCGTGAGCTGCGTAAAGG
AAGCTTCTTTGGAGAGGTCGCTGTGCTCGCAAAGCTGCCCCGATCAGCGACCATGATGACGACCACGTACAGCACGCTGTATCGACTTTCTCGCTTTCAC
GTCGACAAACTCCTGGAAGGGTATCCGCGATATGCTCGTCTCATCTCCCAAACGGTTGACAAAATGCTGAAGAAGGCGAATACGAGAGACGAAGACAAGA
TCAGCGAGATCGCAAGTGCGAGAATGGCTCCAGCTTCGAAGAAGAAGCAATCGATACTGCTGCAAGTCATGTCGCTGAAAACAGAGCAATCCATCTGGAG
GAGCAAGCGGAGCATTTCGTCTGTGACACCTGATGGTCTCGGATCGCCATTGAGCAGCGCACGGTCTGATGCTTCGTCGATCAAGAGAGGAGGGTCCGAC
AAGAAAGTGGTTCCAAGTGATCTACCACCTCCGGTTGAATCTAAGACCCCTCCTGAGGATTCCAGTTTCGTCGTGGCATCGAATGGAATCAACTCGTCCA
GCGTTGCATATAATGTGGACCCTGCGGCTTCAGTATCAGGATCTCGTCCCCAATCACCCAAAGTGCACCCCATCTCGGACGCTCGTATTCCGCCGCAGCG
AGCAACCATGGTCAAATCTCCTGCATTCTTGCTTGGAGGCAACTTGCTCTTTCGCGAGAGCAAAAAGAAGCTGGAGCTGTTTCGGGGAAGCTTCTTCCGC
AAAGGCAAGGTTGGTCCGAACGACGGAAAGCCACAGGACATTATCCGAGGATTCTATGACCAGCTTCCTCAAACTGCTCCGCCACCACCTCCAAGTAAGC
ACTGGTGGGCGAAGTTGCTGCTGAAGAGGTGTATCGATGCCGAATCTCGAGTGCGCATGGTATGGCTTTTGTGCCTGCAGCTAGCTTTGATCTACAACTG
GATCACGATTCCCCTCCAGCTCGCGTTCCCGTTGCTCGATGACCATATTATGTCAATCGTGATCCTGAACATTGTGATCGACTCGCTCTCGTGGATCGAC
ATCTACCTCAATTTCAACCTCTCCTACTCGCTCAACTCGGAGAAGATATTTGAACCAGTACGCAGCGCCAGACGGTACTTCACGAGTTGGGACTTCGTCA
TGGACCTGTGCTGCAATTGGCCGTGCGAAATGTTCAGCCCCTCGAGTTTCAACACGGCAGCGATCCGACTTCCACGACTGATGCGCGTGTGGCGGCTGAA
AGGGCATTTTACTGAAGTGGAGAACTACACGCTCATGAACAGTCGAAAACGGCTCCTCTTCTTCGGGCTGATCCTGATCATGCTGTATCATATCGTTGCC
TGCTTGTACTTCAGCATAACGCACTGGGAAGGCTTTAGCCCTCACGAAGAAGCTTGGATACCGTCGGACGACATCTTCATGCGACAGATCAACTCGACCC
ACTTCATGGACATCCACGGCGACATCTACAGTGCAGACGACCCAAAGGTCGTTGGAATTGGAGCGATGCAGTACTTTCGAGCGCTCTACTATGCAGCAAA
TGTTCTCGCCGCGCTCGGGAAAACAATCGAGCCCGACAGCGACAGACAGTATGCAGTCGCTCTTGGATTCATGCTCAGCGGATTCCTGATCACCGCGATT
GTGGTCGACAATGTTCAACAGCGGTTCACGGCATCAGCGTTCGAGCAAAAGGAATTCTTTGCGACTCGCACGCGCATCCAGCTCTTCCTCAAGCGTCAAA
ACACACCACTGACAATCCATCAGCGCGTGAACTCGTTTCTGGATTACTGGTGGTCGTCTCACCGAGGTGCTATCATCCAGGAGCTCCTGGAAGAGCTGCC
AACAGCGATCAAGCACGACATTGTGAAGAGCATATGCTCCCCCGCTGTGGAATCGCTCGCGCTACTTCGTGTGGAAGACCCGTTTCGAAGCTTCATCTCC
AAAGAAGTCCCAGGGGAAACGCACTCGCAGCTCGAGTCAATCGTACTCGAGAATCTTCGCTTCGTTCTGTATGGTCAAGGAGAGATCATCTACCGGCTGG
GTGATTATGCGAGCGGGTTGTACTTTGTGCTGGAAGGAAGTGTTTCCGTCATGCCGGATGGTGGATTCCCGTATATCGCCCCACTCGGTGGTTTCTTTGG
CACAGCAGCACTGCATTCGCACGAGGTCAGCAAGGAGATGCCGATGGACGGCAGCAGCGGAGCGATTGCAGTCGGATACGCAGAGCACGTGACTGCTGTG
AGCGGCTGCATCGTCGTGTACGTGTCGCGTGAGCACTTGGTTGCGATGGAGGAGGTGTTCCCGTCGCTCTCCATTTCGCTTCACGTCCTGGAGCGTAAGC
TTCGGAGCTCCAAGGTCTCTCGCACACGCGAGCTGGATTCGATTCGTCCAGGACCTCCCTCCAATTCTCCGACGATACAACGAGCGCTACTCGCGGCTCA
CGCCCCTCAGGGCTCATATTGGAGGATTTGGTGCAAGGGCGGCACGGATTTTCTCTGCCTCAACCAAACGAGCTTCGACCCGGACTCCAAGCTGGTCGGG
TTCTGGGAGACATGGATCTTCTTCGCGATGACGACGCAGTGGCTGCTTGTGATTTATCACATCTGCTTTGGGGTTCACGTGGTGGAAATCTCCGTCTCGT
CCTCGTATGTGCACGCAGATACTGTGACAATCATTCTGGAGAGCTGTTTCGTGATCGACATATACCTCCAGTCGTGCCTCGGGTACTACGAGTATGGTAA
CAAGGTGATGGACATCCACACGATCAAGGCGCACTACTTTCGCTCGACGCACTTCCTCGTGGATGTGGTCTCCATCGTCCCACTGTTTGTTTTCAACTGG
CTGAAGCACGACGTACAAAGTCGCATCGAGCTGCTGAACTTCAACAAGCTGATCCGCATTTACAAAGCTCCAAGTCACCTCAAGTCGCTCGAGGGCAAGT
ATGTGAAGCTAGCGAGGGAACTACGGCTCTTCAAGCTCGTGTACTACACGTTCCTGGCATCGCACCTATTTGGGTGTATCTGGTTTGACTTCGCTGCAAA
CTCGTCGGGGCTCCACTCAGCGATCAACTCGCATTCAAATGAGACGACATACTTTGGAGAAAACGCGTGGCTGCCAGGAGAGCTACTTGAAGATGGCAGT
CGGAGTCTGCAGTACTTTGGCTCGATTTTTTGGTCGTTTGGCCTCATGTCGGCGTCAAACACCGGTGAGCTGCCGAAAACGGTGACGCAGTGTCTTTTCA
GCGTCGTGACAATGACAGGAGGATTCTTCTTGTTTGCGTATGTGGTCGGCAACTTCTTGGACGTGATCGAGCTCGAGGATTCTGAGAACCGCGAGTTTGT
CGCTACGATGAGCTCACTGCGCCACTTGCTGGCGCATTTCAAGCTTCCACAGGGCATCCAGGAGAAATTTAAGACGTACTTCTTCTTCAAACGGTTCCAC
TCGATCACACAGGAGCATTTGCTTGAACGCGTCCTGCCACCGTCGCTGTTGGTCGACATCCGCATGTTTCAGCTCCACCCGATGATCATCAAGGTGGCTT
TCCTCGCGGGAATGGAAGACTCGGTGACGCGAATGCTTGTGTCTCTCTTCACGCAGATCCTGTACGTCAAGGACGAGTACATTTGCCGCTTTGGCGAAGA
AGGCAGCGAGATGTTCTTCATTTTCACTGGCACGCTGGAAATCTTGATCCCTGTGGCGCTGCTCACAGGAGCTCCAGCACCGTCGACCCCTCCAGCAATA
CCATCACCAGCAGCTGCAAAAGCGACCACTGTAACCGCGGCATTGCCCCAGCGAAGGACGAGCGTCTCTGAAAACAGCGCCGCTGGATTGCAGAAAGTGA
ACGAAATCACAGCAGGAAGCTACTTTGGTGAAGCGGCGCTCTTTACGAATGCGCCTCGCAACGCGTTCGTGAAAGCCAAGACGTCGTGCATCCTGTATAG
ACTCTCTCGTCAGTCTCTCGAGCTTGTGTTTGAAAGATACCCCGAGTGGAAGAAAAAAGTGCTGCGCATTGTCAAAATCCAGCAGGAGCAGCAGCGTCTG
ACCCGCCAAGCCACCGAAGTGCAGCAAGAGAGCGAGACTGGAGGCGGCACGCGCCGTCGAGGCTTGAAGCGGAACCTATCGCGAATGGACGCGCTGAACT
CTCGAGCGGAGGGCATCGAAGAGCTTCTCTTGGCCCACACGCGCGGCGATAAGAAGAAGTCGCTCACCTTCTCCATCCGGCAGATTCTGCAGAAGTACAA
CTTGCTGCAGTGGCTGCATGCTGCGGCCGCGCCTGTGATAGCAAAAGTTCGAGCTCTGATTGCCTTGCTGGTCAATGGCGCGGAGATCCAGAGCCGCTTC
TACATCCTGTGGGTGCGCCTAGCCTCACTCTGCGCAGTGTTCATCGCTGTGTTTGTGCCCTATCGCGTTGCGTACGACTCGTTGGATCGGTGGAACGGCA
TCCCCGTGATGCTGCGCGTCGTCGAGCGCCTGTGTGAGTTCGTGTTTTGGTGGGACATTTGGTTCAACTTCCGCGTCCGAACGAACGAGGCAGCCATGGA
GCTCTACGAGCAAGAACACTTGCTGGCCTACAAGCGCGAGCGCTTGCTCTGGGACCTCGCGGCGACTTTCCCGCTCGACCATTTCATCGGCGGCTTTGTG
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTT
CTAAAGAAGTGGCTGCGTCTAAACCGGTGCTTGAAGATGAAGAACTTTGTCTACTACCGCAACGAGATCAAGCGGCGAAGCGTGTCGTTCGAGATCGACC
GCGTTAAGACCCTCTGGTTGCTGTACTGCATCGGGATCTTCTGGACGTCGTGTGCATATTTCGCGGTCGCCATGCACGACGGTTTTGGCACCAAATGGCA
GGCGTGGCTGCCCGCGGAAGAGCTCGCTGTGGACGACCCGGAGCCAGATGTGCTGATGCTCCGCCTGTTCCGGGGCCTTGCGTTCGCGACCACGGCGTTT
GTAAAGAAGGGCAGAACGTTCCGGCCGACCAACACGCTGGACTTTGCGTTTAGCATCCTCATCAGCTTCGCGGGTCAACTCATCATGGCGTCGATGATTG
GTGAGATGGCGAACGTGTTCATCCTATACATTGACAACGAGGTACGCTTTCGGAAGAATCATATCACGGCTGAGCACTACCTGGCACGCTGGAAGGTAAG
CAACGCACTCAAGCTGCGTGCAAATGCATTCCTGACGTCCTGGTGGTCGTCATACGCGGGGGTGGACTACCAGATGGTGTTTGACGAGCTGCCACGGAGC
GTGCGTACCGAAGGCGTGCTGCACATCGCTGAGAAGCCGCTACTGCTGCTGATGGAGCGTGTGTTCCGCCCGCTGGCTCGCGGCGCTGGAAAGGAGGACA
ACAGCGGCGCGATGGCGCAAGCTCTCATGCTGTCGATCGCCCAGAGCCTGCGCTTTGAAGGATACCCACGCGGCGAGAACGTGATCGTGGAGGGGAGTGT
GTGCAAGGCCATGTATTTTGTCGTGCGTGGCTACCTGTTCTCCAAGAGTGCGTCAAACCCGTCGCTGTACCACGCGAGTCGCTTCCGCATGGGCGACTAC
TTCGGCGAGAACGGCATCCTGGGCCACTCGGTGAGTCTCATGACGGTCACGAGCATCCGCGCGAGCGACCTGTTCGCACTCGACTCGGAGCGGCTGCTGG
AGATTATCAAGGCCCACTCGTACTTCCAGCTCGTGTTCAAGCTCGCCCAGGACGTCGTGCGGCACAAGAAGAGCGTGAACGAGTACCTCGCGGACGTTCA
GATGGGGACCACGCCGAGCGAGAAGCGACCAAGTGCGGAGAAGGCGCCCAGCAGT