Description :
From Genome Similarity Track
Location :
Scaffold_19:146206- 148188
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10217hypothetical protein

Sequence
1982 bases(100 bases per row)
GGTGAATGTACAGAAATAAAACAATATTCACATCGGCGTGCAGTTATGTTTTCACAAAACTGAAGTGGAAGGTTACTGGTTAAAATTTAGTCCAGCCACC
CGTGTACGTCTCTCGCGCGCTGACGAATCCACGCTTGCAGCGTTCCGCGTCCGTCATCGGCTTCCCGCATGACGTCGGCGTAGTCGGGATGCTGACTCCG
AACGTGTTGAATTAGGTTGCTGTAGCCGGTCCGGGGTCCTTGACGACGTAACGTCCCGCAACGACATCGGAACAGGCCTTCAACAGTTTCCTCAAAGGCG
TCGACCACATCCGTGTAGTAGAAGCTCGCTATACGGGCGTTCGTGTAGTTTTGCGTTGCCATCGGAGAAATGGAAAGTGAGGTCTGAAGGCGTTGGGGTT
TCGATCAATCACTGGCAGCCAACCAAAGCTGGCTGGCTGCGCTGAGTTGAAAATTCGTAACTACTGGAATCTGATTATATCCGTGAATAATTGTATTAAT
GTGGATATTTAGGAAAGTAAATAATTTTAGCCCGGTAATTGTATTGTATTTTCCGTCAATGCATTTTTCGGGATCCCTGGTAGGAGATGAAATGATACCA
TTGGAATCGATGCTAAAAAAAAAAATAGATTCTTTGAATGCTCGTAACTAGGGTGATTTATGAAAGTTATCTGCAATCTCGAAGGACGGATAGCAACAAA
TGTCAGACTCTCACATCCATATGACACAGCACCGCACTTTGAACCAACGTAACATCCTCGAGATCGAGTAGAACACTCGACTATCCATATCGCGTTACTT
CCTCGACACGTCAAGCTCCATAGAGTTTGCACAGCCCGCCTCAATCTCCGTTTTCCGTTGTCTCCCTTGTAGAGCATTCTTCCAGCCCACAGGATTTATT
CTCCAATTTGCGTTCAACCTCCCAAGACAAGCCTGCAAGTCTTTCAAGACTCCATCATGCAGATCTCGACAGTCCTCTTTGGTCTGGTAGCTCTATCGAC
GTCAACGTTCTCGACTGCTGCTGAGCCGCTTCCCTGGGACGGACGTGCACAGGGGCTTACAGTCGACACATTAACTGGCAAGTACATCACGAAGATTCTA
ACGCAGCGCGACGGCGAATCCAAGGGATCTCCTGCTGACTACGTGACGGTCAAGGAAAAAGTTCGATCTCCTGCCTACAATGGTGATACGGGCGTCATTG
ACATTGGAGTGAACGACAAGGCCGTGTGGGGCTCTGAGGTCTATTCACGTCGTTCAGAGTTGGTGCAGAACATCACCACCAACTCGACTGGCACCACCTT
TTTCCGTGCGAGTGTGCTGAAGAACGACACGTTTTACTACCCGTATAGCTGGAAGGTGATCTTCCCAGAGTCGCAGCTCTTCGAGATCCACGTGGATGCC
AGATCGGATTTCCCAAGCATTCTCTACAAGACCAACGCTACCAAGGAGGCCCAATGGAAGGCCAACTTCAAACTTGACACCTGGTACAACTTCGGTATCG
GTATGAGGGCTGCTGCGGGAGGTAAGGGAACGGAACTGGAATTTTACACAAGTACAGGGGACGAAGATCTGGTGCTGAATACGACGACGAAGATTGCGTC
CGAACTGCCGTCTTCCATTGAAATGCACTGGGGTCTGTTGACGCAGGTGAAGCAGTCCAAGACCGCCACGGGTCCAGTGATGACTAAGAAGCAGGAGGTG
CTCTCGTTCAGTGGTATGTCGGCTGAGAGTGGAGTAGTGACAGCAGCAACGACCAGCGCCTCTAAACAAGCAAAAAGCACGACCGGAACTGTGGCTGGAG
AAGCCGACGAGGTTCATCAGACAGGTCAGAAGTCGTTTACATTTTAGACACGGGGTTGTTGTTCACGTCTGCGTCAAACGTATCGTGGTATACATATACA
CACTAGCGGTTTAGGAGCGTAGTGGGCAATAATATATTGCTTTGCTTCGTTACAGAGCTTTTCACACAAGGCTTTCGCAATG