Description :
From Genome Similarity Track
Location :
scaffold_140:14619- 15786
Transcript NameFunction/comments
g6786.t1hypothetical protein

Sequence
1167 bases(100 bases per row)
GGGTGACCACGTCGAAACCTCGTCACAGTCGGCACCAAGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCC
GGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAAGCTCGGTAGGACCACCGAAGACATGCTTACGCCCGGGATTATCGTCATCCATCATGTTTTGCGT
CTTGATCAATGGGATCCTGACCTCGTCCGGGAGTTGTACATTGGCGTGAAATAGGTCGAGGCGAATTCCGACTGGGATCATAAAATCGGTGCCAAGCACC
ACATCAACTCCAGCACTGTGATCCATAATCCACACCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTA
TCTTTCCTTTCTGTATTCCTTGCATTTCCAGCCGTCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCAC
ATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGTGTGTCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTTACTCTTCGGTCGAACTTCTGCGACGAC
CACCACCCCAGTCGTTCTCCTAGTAGCAATCTCACCGTCTTGGCGAGTCCTCGAGGTAACTTCTCCTCAGCCACTGCACTCGAGACCCAGGCTTCGCACT
CACTCTACCCGCTTTCTTCATCTTCACTCACATCGCCTCCACCGAGGTTTAAAACTCTCTCCTTTTCATTGTCAGTCCATTTCACTCTATCTCCGTCGTC
ATTATTCGGCCATTCGCACTTGCCCACATACGCGTAGATACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTT
TCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATACGAGGGTCTGGAGCTCGGGCGAGAGGTCTTTTCTTGTCAACCTTGTTCTTGACGAGGTTTGCGA
GTTCTTGGTAAGCTTCGCACTTGCCTGCATCATGCACTTGTTTGCATAGTTGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCA
CCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGGTCTCGACCACGAAAACGGTCAC