Description :
From Genome Similarity Track
Location :
Scaffold_90:14615- 16772
Transcript NameFunction/comments
Physo_140798hypothetical protein
Physo_140799hypothetical protein

Sequence
2157 bases(100 bases per row)
AGCCGATCGGCCAGTTCCGGATCGCCCAGCGTCTCGATAAAGTGTTCGACATGTTCTCGGCGGGCCTTAGAATCTCCGTCCTTGATCTTCAATCTCGCAC
GCAGAGCCGCCACATTCAGTCGATAGAGGTACTCCAACGGCGATTCATCTGATCTCTTGAGAGAATGGTAATACTGCCAAGCGACCGATACTCCCAGGCC
ACAATACTGGATCTGGAAACTCCGGAGTAGATCGCTCCACTTGTTCCGCGTCGATCGGCCCAGCTGGCGGTACCAGTTCTTCGCCGGGCCCGTCAGTAGA
TCAGCGAAGGTCAGGCACTTCTCTTCGTCCGTAGCCTGATCTCGCAGGAACGCCGACTTCACCTTGCTGATCCACGATCGGGCGCGGTCTTCGTCCTGAT
CCTTGCCACTGAACTCCTTAAGATCGGACATCGCCGAAATCCGCACACGCTGGATCAAGGAGGACCCAGTGGATCCTGAGGCAGCGGTGGCCACCGCAGC
AGGGGCCACCGCAGCAGGGGCCGAACTCGGTAGATCAATGTCGTCCGGATCGTATTCCCACTGAGAGAGATCTTGATCCGGCGATCCGGCTGATTCCATC
TCCACGTCCCGCGATCCAACGTTGTCGTCGACCACTGGAGTAGGTGTTACCACCGTGGCCTGTTGTTCCTTCAGAAATCGAGCCATCGCAGCCTGAAAGT
AAGAATCCAGTCTGCCATTCGACTCATCTGATTCGGTAGCACTGGTGGTCCGATCGGTCGACTTGGGTTTATGCTTCCGCGGTCCTGATCGCATGCGTTC
CTGACGTTGACTCCGAGATCGTGCGTCCAACATCGCAGATCCTGAAGGGTCGAGGGACATCCGTTGAGGTTCGGATGACGTATCCGATACATGTTCCGCT
GCGGAGACATAAGGAGACGACGATCGGTACCCAGTGGACTCCATCCGCGGCGACGACGCGGGATCTGGCGACACTAGATCTGGCACCTTCGGGTCCGGAC
TGTCCGCGATCACGTCGACCAAAGGTCTCAACTCGTCGACCAATGTCTGGATCACTGTCTGGATCACATCGAGATCTTGATCGAAAAGATCGTTCGCTTC
AAAGGCGCCAGCTACGAAGCCGGTTTCCTTCAACAGCCCGAGCAGATTTTTCACCGCCATCAGCTTGTTATCCGTCACTCGGGGGGGCCGAGATCGGGTC
CTTCTGGTCGTCGATCTGCTCTGGCCGCACGATCACCATGACAGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCCAGGTTA
GCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAAGCCTGGCGCTCTCAGCTTCTTCCTTACGATCTGGGCCTTGTCCGCGATCGCGT
CCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCAGCGAACGCGTATCGGTCCGATCCCGCCTTAGCTTGTTTTGTTAGTGAATCTCGGTTCGCACCAAG
ATGCACCGGGGTCCCCGAAGGGCCTTAGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAAGTCCTCCGAG
CACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGCCGATCCGATATCCGACGACGCCTCTTCCCGGTTCTTTCTTCACTTGCGCATCTT
CTACGGACTCACGGTGAAATCCGGAGCCCCCAAGAGATCCAGGCACGCGCACCATTGTGGTGTACCGGGATCGGCCAAAATCTTGTTAAGGCCTGATCGA
GCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGTGGGCTG
GATCTGCTCTCTCAGGGCTCCGAACATGCAGCACTTGGTGGAGATCGAGTGTATTGGCGAGACGCGGGGATTGTTTGTGGAGCAGCGCGGTAATCTTCGC
TCTGCGTCCGAGTATTCGCTCCGATCGAGGGTTGTTCGCTTCGATCGGTCGGTCTGGAGTAGATCCAAGGCCTGTAGTTGCCTTTCCGGGTGTGTTCCTT
CCTTTCCTGAGCTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAAGAGA