Description :
From Genome Similarity Track
Location :
contig_17:146139- 147313
Transcript NameFunction/comments
g4741.t1hypothetical protein
g4742.t1RAW26443.1 hypothetical protein PC110_g17154 [Phytophthora cactorum

Sequence
1174 bases(100 bases per row)
GTCTCCACGTGGCCAGCGACTTCTGCAGCTTCTGCTATATTGCTTCAGCTTTGACTGGGAACTTGGTCGGCAGCTCAAGCTCCTTCTTGGGTGTGGTGGT
GATCACGGCCGTCCGTGTGTCCATGTCCTCCATAGCTCGAACGAACTCTTTACTCTCCAGCTGCCCGAACGGGAGGCCGTAGCGTCGGTTTCTCCTGGTG
GCGTCGTCCGTGGGCGCGTCTCGTTTCCTGTCGAAGCAGCCCCGGGTCTTAAACGCCAGCAGCAGACCGCAGATCAGGGACACGACGGCGTACAAGCCGC
CCGCGATGTAGCAATTGACCTCCGCAGAGCTGGAACGCACGTGCAGCCCGCGCACGAAGCCCGGCTGGAACCGCAGCAACAAACCGAAGACGGGAATGAG
GACCATCCCAGCCAGCGACAGCGCCATCGCGGCGCGCAAGTAGCTGCTCTCCATGTCGATGTCTCTTCTTGGCAAGAAGTTCGTACTTGAAACCCATGTA
ACCTCAGGAATGAGATAGGTACGTAATACCCCTTTGGGATTGGTAGATAAAAGTGATAACCAATCATATCATCGGATTGAGTAGCCATTTTCCGGTGGGC
GCCTTTTGTTGTCTGCTGCCAATGCAAGTCAATTTTTGTCCTATGATGCTATTCAGTTGGGTTACCTTTTCCCTGCACAGGCAGTCTACAAACCGCGCCA
TTCTACCTTTGTGCATCGCTCTTTCCTCTTCAAGTTCGGCTCTCTCTATGCGCGTGTGCTGGCCGGAGCCTTGTGATCACGGAAGCTCTTGAGCTCGGCA
AGTCGCACGAAGCGGTGGTAGATCAGCGGGTGCAGCTGACTGAGCCGTCCCGGGTTCTCGGCGAAGCACACGAACAACGTCTTGATGACGGCCGCGATCA
CTTGCGTGGCCAGCGAGATGGTCGTGTAGCAGAGCGTGAACGCCGCCAACGTGAAAAACGTCGCGTGCGACGATGCACCAGCAAGCGCCGACGCAGTCAA
CGCACTCATGATACCTGCCCAGCCATTGCCACCGAGAAGCAGGATGCGGCTCGTCAAGTCGTCATCCACGATCGCCTCCACGCCGTGATGCTCGATCAGT
TTCCACGCGTCCTGCGCCGCCACATAATAAGGCTTGTTGTAGCCAGCAACGTGCACGAACGAGTACTTGTGGTA