Description :
From Genome Similarity Track
Location :
Scaffold_6:1461146- 1462211
Sequence
1065 bases(100 bases per row)
CGTTCGCGGCCTTCATCGTCGGCCTGCAATAGCGCACAGCCAATTGCGTAGTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATG
CCAGGACTGGCGCGCGCTGTAAGCTCACTTTGATGTCGTTAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGA
CAAGGGCCGTGCCAGCTCGGCGTAGCCTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGGCGGCCAAGCCGCGAT
GGTTTTCACCTTCTCCGGGTCCGCCCGGACCCCGGCGCTGCTGACGAAGCAGCCCAGGACCTTGATCTCCTCAGCTGCGAACACACACTTGTCAATGTTG
GCGTACAGCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGACGA
AGATGTCGTCAAAGTACGTCTGTGTGAACGCACGCAAAGGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAGG
CATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTCACAGCCGTGAGTGGGATGTCGCTCTCGCGCATCAGGATCTGGTAGTATCCGTCCACCAGG
TCCAGCGCGCTATACAGCGTGCAGCCGGTCATGTTGTTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGTTCAGCTTGT
TATAAGCATGAACCAGACGCCACTTTCCGTTCGGTTTGCGAACACAGAAGGTAGGCGTCGAGTGCCGGGACTTCGACTCCCGCACCATGCCTGCCTTCGC
CTTGGCGGCAAAGAAGGCATCAATGACTTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCACG
TGCCTGATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCAAACTC