Description :
From Genome Similarity Track
Location :
Scaffold_359:1461- 4779
Sequence
3318 bases(100 bases per row)
TAACCTTATTCGATAACGATCACTCGTCGTGTCAGATAGACGAGCCCACACTCTCTGAGGAGGTAGCCACGGCTTCTTCTCAGGAGCAACACGCAAGATG
TTGCGATCCACAGTCTCTTGTGTGGTTTCAATAGAAGCACCGACAGCAGGATCATCCCGATCACTCGATGCATGATTGCATCACCGTCAAGATCGTTATG
GTGGCCAAAGCCATGGCTTTTCTCGCTCTCAGCAGAACGACTCCGTCTCGGAGACGGAGGGTCGGACTCGTCGGACGATCTGAAGATGTCACGACGACCT
GCAAGGCTTCAAGCACTTCGAGAAGCCTACTTAGTCGGCTCCGGTTTAGCCAACTCTGGCTCATCCTTGACTTTCGCCTCCTTCGAGTCGGTCTCACCGT
CAGACTCGCCAGAGTATATGAGCTCAAGCTCATAATCTCCGATGTCACGTGGTGCATCACCGCGTGCGCCTGCAGCAGCGACTGGTGCAGGCTGAGTCAC
GGAAGCAGCAGACGAACTTACGTCAGCTGCTTCGGGTGATCCTGTCTCCCCTGCGGCAGCAGAGCGAAGTCTCATGGCTGCGTTCTCAGCAGCTTTGGCT
GCACACCGCATGGACTTGTTAACCATGCGATGAGAATGAAGAATAGATGGATTGGCCAACAAGTGCTTCCCTGTCCCCGAGCCACTCAAAAGAATCATCC
AATAGTCAATCAGTCACTTATGTGACTGATGGTTAAGGGGGGTGATGCAACGGGGTGCCTCCGTTACATGATAATTACATAAGGTCAATATCAAGTATGA
ATATTGCGTTAGGACAAACACAATATTCTCATATTATTATCCGAATAGATAATATTGCCCCATAGATGTAATACACTGCTCATTGGTTGATATAGGATCG
AGATATCAACCGATAAAGTCTTAGCCACGACAGAAGCACGCAATGAGTGGCGCGCAGATAGTTATAATACATGTTTGTATTTAGACAGAGTTAAATGAAT
TCAAATAAGGATTTATTACGAGGACTAACTATACTAAATACAGTTCTACTTTTTACCTTTACTGAGTACTCTTGCTCCGTATATCAATCTTCCTCTGCAC
GTACGTGTACGTGAGGTAGTCGGAAGCACACGCCCTTGCACTGTCAGCAGTACAAGGTTTATTCAGTTACTTGAATAAGGTGTGCCCCGTTACAACCCAA
ATCTTAGCGAGTTCAGGTAATGTCGCACCGGATGTCACCGCAAATGGCACGCTTGCTGCAAGCGGCAACACATGGCTATAAGTTACCATAGTAGGCTTTG
CAGTAGCTTTCAGCCAGCTGCGCGATGGTCACAGCTGATCGATGAACATTGTCGGTAGCCGCCGTGGCCCTTTATAATACACGATTTTGTTGCAGGCTAC
ATGACAGCGTTTACCTCTACCGGAAGGCAAGTAAATGAGCCGAAGATGAGCATATCTTAAGTAAAAAAGCTTTAGGTGCATTTCGTACCATGCAGTATGT
AGGGCACCACCACTCTGAGTCCGCTTTTTGCATTTAGATTAACACATCTCTTGCCATCGCCATGGACTTAGTAGAAGCCTCTACTTTGACCAATTTCATA
CAGGCGCGTTCTTGCCATCTCTTGCCACCACCATGGGTGACACAGAACCCACGGCTCACAACGCTGGTCGTGCATTTCTACCGAGCACATTTTCCTCCTC
CACGTGAGATACAAAGGCCGCCATGCTTGGCAGTCTTGTCACACGCTGGAAATCCACACCGTCGCATCCGCAAGCTATTTATGTGCTTTCTATTCAAGTC
GATACGTTTGCACGCAGTCTCACTCTCCCAATGCTTACTGGTGAGGATTGAGCGTTGAGTTTCGGTCGTACTTGTATGAATTAGCTCAAACTTGTGGCTG
CCCAGCAATTGCCCAACCAAAGCTGGGCCAATATGCTGCAGCCGAATGTTTTCGAAAGCATATCCATGACCAGAAGAAGCGCGTCATCTCATATCCCAGC
GAGCTTTGTACAGGAATCAGATGTGATACACAGCCATTGTGATGGCACTTGCGGCCTCCAAGCTGGACTCCTCACTTAATTTTACTACGTTTGTCATTTG
ACGGTTTACCATTCCACAACTATACGTTAAATAAAGCGGACGCCAACAAAGTGCGGACCTGCTGCTAAGATGTCAGGCGAGTAGCAAGACATCGAGTTGA
GAAGTACACATATTTTTCTCTCTGTGTCTGTGAGTCTGTAGTCTTGCAGGGCTGAGCATGCACCAACAGACAACTCGGGGGACCAGACGGCCGCTCAAGT
TCTCTGTACGAACGATGCCAAATAGTTTGTCCACATGAGTTGCACAGACTGATTTCTCAACCACCTCAGCTACAGAAAGGCTTAACATGTCGTTCTATCG
CTCGTGCCCTAATTAAGAGCTGTGGCCGACAACACTAACCCAATTTTTCACATTCAAATCTACAGGAGATTCTTTTAAAGAAACGCCGGATGTGGTGCTA
CGTTTGATGCCAAACTTTGGTGAACGGCGCAAGAGCAGATTAACGACCTGGATCGTCCACATGATTCCATTGCGGAAGTATACAGCGGTCTGTTACCTAT
TTCTTGCAGGACGCTACATATAGAACTATTGGCCATTTTTAACCACACCTCGACCTCTGGACTTATTAATAGATAAAGGTCCGACAGCATCAGCACATAG
CCACAACGCCCATAATCATACCTTGACAGTACTATTCCTTGATGTTTATCAGTATAGACACTACATTCTGTTAGTAGAGGCGACTCGAACCGACGTGTGT
GGCCGCCAAGTACATAGACAGCAAGTTGATTTACGAATTACTACTCTACAAACCCACTGCACAGAGTACAACATACAACATTCACGGACGGCGGCAGATC
TTCGGATAGCAGATTTTCAGAGGCTCGCGATGACAACGTTATGATCGTGGGCCCAAATGTATCGACAGTACCGAGTTTGGAGATGTAATGCTGAGTAACA
TTTTGGAGCTTCAACGATTAAGCAAGACCGATTTCTCCTTTTCTGACATATGTGTGAGCCCTAAAACGAGTTTATGATTACCGATCTCAATAAACTTGTT
GGTATCCGATGCCTCTGACTATGACTTGGACTCTCACTTACAGCACATGTCATCTCGTATCTTGCTGCATGTGTGAGCTCAGTTCTTATAATATTATGGG
TTTTGCATCCCTGCTTTGGGGAAGGATGTAATGTGTCAGGCATACTCACATGAGTCGTTAGTTTACTAATGCGACAATCTATCTGAACAGCTCGTAGTGA
ATCGCACTCTCATTTTTT