Description :
From Genome Similarity Track
Location :
Scaffold_466:1461- 3722
Transcript NameFunction/comments
Phyke_g9702hypothetical protein PHYSODRAFT_361176

Sequence
2261 bases(100 bases per row)
TTttgatgtggtccacttTTTCAACCTACCGAGGTTTTTTAGCTGTTGGATCCCAGAAACCGCCTCACAAGCGGGCGCGCAGCACCAAGGAAGCTATAAG
CCTATTTCGGCTCTCGACGtacagcttcagcagcgcttaGTGGTGGCAGGAGGTCTGTGATCGTCgcctccatcgtcttgtCTACTGATCGAGCCTTTGA
TCTGGACGATTCAGACGATAATTAGCGCCGTAGCAAGCGCAAACTGCCTACTACTGCCACTTGCTGAAGCATGGGGGGCGAGTGCGTGCCGGATCATTGC
CGCGAGTGCGGCAGTGCGGACGTCGTGACGGACTTTAGCGCGGGCGACGTGGTGTGCCGTAGTTGCGGCATGATCCTCGGTGAGCGCATTATAGATGATA
CCCCCGAATGGAGAACGTTTGCTAACGATGATCGGGGTGGTGACCCCGCTGCCAAATCCAGGGTCGGCGACACCACGGACGCGCGGCTCGACAGCCTCTC
GCTGTCCACGTTCCTAGTCGACCCGGTGAAGGGAAAGAGCTCTGGCGGGGGAGGGGCCGACGTGGGACAGAAACACAAGCGCCCCAACATCTCGTCGGAC
AGTGCCAAGGTCAAAAGGATGCAACGCAATATGCAGCGCATCCAAGAAGTCGCAGACTACCTGTCGCTGCCCAAGAACATTGTAGAGATTGCACTGGATG
TGTACGCTGAAGCGGAGAAGAAGGGAGTGAATATTCGAGGACCGGAACGAGAAAGTATGGCAGTTGCGGTGCTATTCGTCGCGTGCAGGAAGTCCGGTAA
TGCGCGCTCGCTTAAAGAGTTCGAAGACGCTTCGGGTATTGCAAAACGACGGATTGGCAAGTCGTTTATGAGTCTGTCGCGACGCCTGGACATTGAGATG
ACACAGCCTTCAACGGAGGAGTATGTCCGGCGTTTCTGCTCAAGACTAGGATTACCAAACAAGACACAGATGATTGCGCATGCCGTGGCAAAGAAGGCAG
ACACTTTGGGATTATCCAATGGACAACCTCCAGTGGCAGTAGCGGCTTCAGTGATCTATTTGGTGGCAGCTTACACGAACGCAAAGCGCTCTATTCAAGA
GATCAGTGACGTGACAATGATTGGCGAGAAAAGCATGAAGAGGGTGTGCAAGGAGCTGAACAAGAGTCGTGTGGTGCTATTCGAAGGAGTGGTGATGACT
TAGACGAATGAGGACGTGACGCCGGAGTGGCATGACGTTATGGTGATGCGAGTGCAcggggtggtggtggagaagaccTCGTAAGTAAAGCAGGAAGGAG
GTCCACCGGGCACTCAGGTTCGTATATATTTATAGGCGGCCACTGCGCTTCCTATTGCATGGTAAGACAAATCAAGATGCTCTTGAACCAAGGGGTAGTC
TCTATAGATGCTTGGGTACTGCGTTTTGCTTGCTTGCTTGACTTACGTGACTGACACTTCTTTGCTGTTGACATTCTTGTTGTCAGGGATAGAATATAGA
GATAGAGCTACAAGATAGAAGACTTAACGCCGCAGCACTCATGCGAGCAGTGCTGTATGGGTGACAGACGTAAGCATGTCGTTGTTGTACACTACGTAAT
GTTATTGGTTAACTTCCCACTCAACGCATAATCTGTGACGGGAAACACTTTGTCCTCTGCCTAGTAGTAAATGACACGTCCTGAGTGAGCGAAAAATGGT
TGTGGCTGTCACTCGTACACGAGCTGCCCGATCTCTATCCAGGATGTGCGTGTTCGTTGGCATCGTTTCAAGTTCCAGACGACGCCGCGATACAGCAGCT
CCTCTCGGTTGTTCAGTCGACGCTGCACCAGGTCCAAGTTGTCCGACAGCTGCAGTACAAATGACACAGTTGTAGCTCAATCCAAACGACGCGAAGACCT
TCAAAAAGAGAAGAAACAGATGCAGTGCATGTCCGTACCTGTCTGGTACAGGGCTCCGAGAAGCATAGAGACAACCCACAGGTTGTAAAACACCACAGAT
ATCCACAGCCATAACATGGAAGACACGGGAAATAGTCTTCCACTGTTTGGTTCAGTACGTCAATACAGAACTTGAACTCCCTCCTAGAAACTGCATCAGT
CATAGACGGCTGTGTGAGCTTCACTTTGATACGCAAAACGGAGTGATGAACACAGTAGAGTTAACGATCTGTCTGGAGCACGTACTGATTCCGTCCAGCG
CTGTGGGGAATGTGTCATCGTATGCGGATGAATATCCGCTCACTGTCTTGATCCCTGTAGC