Description :
From Genome Similarity Track
Location :
Scaffold_2598:1461- 2712
Sequence
1251 bases(100 bases per row)
TCCACTCCGAGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGCAGGCTGAGGCAGAAGAAGAAGTGAGCTCGTCCTCGGACTGCGTC
CTCGGACGGCATCTCTCCCTTCTGCCTTCAAGTCCTCATCGCACTCGTGTTTAATTGGCAGGCAGCCTCTGCCTGCTGGTGCACTCTATCCAAGTGCTCT
TAGGATCTGTTTTACTCTAGTACTTACTATTGTTTTATTAAAAGTAAGGCATTTATTGTGTTGACACACTTAATTATGTCCAGCATCTGTGTGGCCTCTA
CCGACCCTTCGCCGCCTTCGGCGACTCGGCGTCTGATCGCCATGCTGGCCAATTCTTCCACTAAGTACTAGGGGTAAGCACTAGATCCATCACTCCTAGC
TTATGCCTGAGCTTTAGGAATTGTTAGGTTGACAATCCTTTTGTCAGAATAACGGCAGCCATCTCTGTTGTGACACAATAGGTTATCTTGAGATGACCAT
GGTCCACCAGATATCTCGTAAATAGATACCGTAATTCAATGTGCTTGTTTGCTATGTGGTTTCCTGGGTTTCAGACGATGCTGATGGCAGCATTGCTGTC
GCACCAGGCTTGCACCGGACCCTTTTGTGGAAATTCCATTTCTCCTAGAAGATGCCATAGCCACTCGCTCTCCTTGGCACCTTCGCTTAGTGCGGTGAGT
TCTGCCTCAGCAGTAGAGAGAGAAACGCCTTCTTGCTTGCTACTACACCACGCCACGCTGGTTCCAGCCATTTTAATCAAACAGCCGGTGACTGATTGCG
TTCTTTTGGTTGACACGCGAAGCTCGCGTCATTCGTAAGTCACGTCACTCTCTTTTCCCTCGAGTAGTAGACCGTACGTCGACGTCCCTTTAAAGTATTT
AAGGACTCGTCTAGCCGCTTCCTAGTGTGTACGATTGTAGCACGATAGGAACTTGTATAATTCTCTCACCGCGTTGGCAATGTCAGGTCGGGTTCACGAA
CCAGGTATTGGAGTGATCCAACTATGCGTCTGTAGTCGAAAGGCTGCGATGCTATTTGCGCAGCATTCATCTTCGTCTTAGCTTCTAGCGTCAACCCTGG
TACTTGTGGGGTTAGTACAGGTGTGTTGTTCACCATGTTGTACATAGCTATCAGCTCAGCGATATACTTGCGTTGTGAGATCATCATCACTCGCTGCTTT
CTGTTGCGTCGCACTTCCATCTTAAGGATGTAGTGAATGTCTCCCAGATCT