Description :
From Genome Similarity Track
Location :
Scaffold_143:14606- 15760
Transcript NameFunction/comments
Physo_143547hypothetical protein
Physo_143548hypothetical protein

Sequence
1154 bases(100 bases per row)
CCTTTTCAACATAGCAGAGGCCAAGGTGGTGCAGCACGGTATCGGTCACTACGTTCCGAGCTCAGAAGACCCGGCGATATAGACGCTTTCGTTGGCGTCC
GAGTTCGTCAAGCGGTCGCTATTTGAACGCTGGAACAGGCTGGAAAACATCAAACGGACCAACGTTTTTCGGAAGTTGCAGGATGTCTCGGATGCCGCTT
CGTTTTGTGACGTCCTGTTCGACGAATGTGAGAAAGCAAACAGGAAGGCTAGCACAGAAGCGTGATGGAGACAGCAAAAGGGACACAAGTTAATTCTAAA
CTTTAGCTAGATCTTCCTGCATGAACATCAGGAGAAGAGGATGTACAGCCACGGATCTGTCTGCAGTTGTGTGAGCTGTCTTGACAAGCTAAATTGCTCA
TGAACATGGCTACCGCCTTTGTGTTTGATGCTTGTGATTCATGAGGAAACGAGAATCAATAATTGGTTGATGAATTGGTTGTTTGTGAATGGATAGATTG
ATGGATGGAGACTGGCATTCGTAGTTTCTATTCTTCGCGACACCGTAGTGAACGATTTTTAAATCGTTTTAAAAAACCATGAGTGCAATTACGGGCTCAG
TGTCGCCGACGACTATGGCGTACGACTACCCGTTCAGTGACGACGAGAATAGTGAACTTGGTCCACTGAAGCAGGAGTGGCCGTTCGGTGGAGAAGGAAG
GTCCAAAGTCGTGCCAGTCCCCGGATAGAGCAAAATGTCAAACAATCAGCAAACTATTGGCTCGAGCGGATCGACAGGCTGGCGAGTACTCTTTCGGAGG
TCGAGCCGACACGTTGCCGATCGTCCCCAGTCTCGTTGTCAAAGACGTTGGGCCAGGCTCGGTCCCACTGACTGAGGAAGAAGCTACAAACCTGATCGGC
AAGAGCAAGAAATCTCCGTTTGGACACAAGTTTGAGACAAAACTGGACGAGAATGTACGCAATAGCTGGCAACTGGAGCCTGACCAAGTCGAAATCAACA
ACCGGCAGTGGCACACCGGCATTGAGGAGATAACCGCTACCATTGCAGCACGTTTGGGGTACGAAGGCGTTCCTCTAAGCTGTCAGCTGTACAAAATGCT
CATCTATGGACAAGGAGGGCACTTTGTGAAGCACCAAGACACTGAGAAAGAAGA