Description :
From Genome Similarity Track
Location :
contig_140:14602- 16313
Transcript NameFunction/comments
g14266.t1hypothetical protein

Sequence
1711 bases(100 bases per row)
ATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGCACCAAGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGC
GTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAAGCTCGGTAGGACCACCGAAGACATGCTACGCCCGGGATTATC
GTCATCCATCATGTTTTGCGTCTTGATCAATGGGATCCTGACCTCGTCCGGGAGTTGTACAGTGGCGTGAAATAGGTCGAGGCGAATTCCGGCTGGGATC
ATAAAATCGGTGCCAAGCACCACATCAACTCCAGCACTGTGATCCATAATCCACACCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGA
GTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCCGTCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCAT
CTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGTGTGTCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTCACTCTT
CGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCAGGCAGCAATCTCACCGTCTTGGCGAGTCCTCGAGGTAACTTCTCCTCAGCCACTGCAC
TCGAGACCCAGGCTTCGCACTCACTCGACCCGCTTTCTTCATCTTCACTCACATCGCCTCCACCGAGGTTTAAAACTCTCTCCTTCTTATTATCAGTCCA
TTTCACTCTCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACATACGCGTAGATACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCC
GTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATACGAGGGTCTGGAGCTCGGGCGAGAGGTCTTCTTGTCAACCTTTGT
TCTTGACGAGGTTGCGAGTTCTTGGAAAGCTTCGCACTTGCCTGCATCATGCAGTTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACC
GCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGGTCTCGACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTT
GGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAGTTCGTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGT
AGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAAGTGTTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGC
ATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTCAACGTGGCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCG
TTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAGGATCGTCAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGC
GACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACGATCTTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCAC
CTGCAAGTGTC