Description :
From Genome Similarity Track
Location :
contig_17:146013- 148943
Transcript NameFunction/comments
g4987.t1hypothetical protein
g4988.t1RAW26443.1 hypothetical protein PC110_g17154 [Phytophthora cactorum

Sequence
2930 bases(100 bases per row)
GTGCCGACGAGAGCTCATAGATTGTCGGCTTCTCGTCTTTCGCTACTAAACTAACACGTCGAACTGGGAGTGAGTCGCCCTAACGTCTCCACGTGGCCAG
CGACTTCTGCAGCTTCTGCTATATTGCTTCAGCTTTGACTGGGAACTTGGTCGGCAGCTCAAGCTCCTTCTTGGGTGTGGTGGTGATCACGGCCGTCCGT
GTGTCCATGTCCTCCATAGCTCGAACGAACTCTTTACTCTCCAGCTGCCCGAACGGGAGGCCGTAGCGTCGGTTTCTCCTGGTGGCGTCGTCCGTGGGCG
CGTCTCGTTTCCTGTCGAAGCAGCCCCGGGTCTTAAACGCCAGCAGCAGACCGCAGATCAGGGACACGACGGCGTACAAGCCGCCCGCGATGTAGCAATT
GACCTCCGCAGAGCTGGAACGCACGTGCAGCCCGCGCACGAAGCCCGGCTGGAACCGCAGCAACAAACCGAAGACGGGAATGAGGACCATCCCAGCCAGC
GACAGCGCCATCGCGGCGCGCAAGTAGCTGCTCTCCATGTCGATGTCTCTTCTTGGCAAGAAGTTCGTACTTGAAACCCATGTAACCTCAGGAATGAGAT
AGGTACGTAATACCCCTTTGGGATTGGTAGATAAAAGTGATAACCAATCATATCATCGGATTGAGTAGCCATTTTCCGGTGGGCGCCTTTTGTTGTCTGC
TGCCAATGCAAGTCAATTTTTGTCCTATGATGCTATTCAGTTGGGTTACCTTTTCCCTGCACAGGCAGTCTACAAACCGCGCCATTCTACCTTTGTGCAT
CGCTCTTTCCTCTTCAAGTTCGGCTCTCTCTATGCGCGTGTGCTGGCCGGAGCCTTGTGATCACGGAAGCTCTTGAGCTCGGCAAGTCGCACGAAGCGGT
GGTAGATCAGCGGGTGCAGCTGACTGAGCCGTCCCGGGTTCTCGGCGAAGCACACGAACAACGTCTTGATGACGGCCGCGATCACTTGCGTGGCCAGCGA
GATGGTCGTGTAGCAGAGCGTGAACGCCGCCAACGTGAAAAACGTCGCGTGCGACGATGCACCAGCAAGCGCCGACGCAGTCAACGCACTCATGATACCT
GCCCAGCCATTGCCACCGAGAAGCAGGATGCGGCTCGTCAAGTCGTCATCCACGATCGCCTCCACGCCGTGATGCTCGATCAGTTTCCACGCGTCCTGCG
CCGCCACATAATAAGGCTTGTTGTAGCCAGCAACGTGCACGAACGAGTACTTGTGGTACGTGCGGATAAAATACTCCACTCGCTCTGAGCGCAGCGACAT
AAATCTCCTTGAAAGCACCGACTCATCTCGTCGTGCCCAGCGCAGAGCGTTCCACACGAGATGAGCCAACGGGCACAGCAGTGAGCCGATGCAAATTGAT
CCGAACGAGCTCGACATCGCGCAGCGTGCGTAGTGCAGCACGACTTTCCTGTCCAGGTAATCGGTGCTTGGATTCTGTTGCACTTGGCCATTGGCCTCAT
CGCTCGGGGAGTCGTGGTCTGAGATGTTCTCGCGAATGTCGGGCGAGATCTCAGTCGATTCGTTGCGGTAGTACCAGATCATCGTCGTACCGGAAGCCAC
GATCGTCAAAATGTTCTTGAAGACGTTGGACATCCAGTAGAAGTGGAAGACGAGGTAGATTATCGAGAAGTTCCAGGGCGACAGATCGCGGCCAACATAG
CCGATCGTTGTGCAGATCCAGCTGGCCCAGATCGTGTAGGCCACCAACATAACACACGTGGCACCCCCCAGCGCCGGATGGGCTACCAGAAATTCCACGA
CCAGCTCAAAGAACACCGCGACGAAGTCCAGGCCGTGGTTGGCGCGTGCGTACCACACGAGGTCCAGCACCACGACACCACTGCAAATGACCCCCCAGAA
CATACCCTCGCCCGACTCCAGCAGGAAGAGCATGGCCGCCAGCATCGACAGCCCCGCCATGGAGAATATACACGACCCCTGCACGAAGCGTAGCTTGGAG
TAGAAGATAAAAAGCAGCAGCCAGCCCAGGGCGAACAGCATGTTCACGACGCAGAGCGAGCGCAGCGCCACGCCTACATCTGCGTCGTCCTGCGCTAGAC
TCGCGTCCTGTTGCAGACCGCCCACGACGTCGCTGCGCTCGTCCGCCTGCTCCTCCTGCTCGCCGACCGCGCGGATGCTGCTGGTGGCTACCAGCATCAG
AATCAGGTGCAGCACAAAGAGCCCAGCGAACGGAACGTCGCGATACATGAGCGGAGAGTGCAGCGACGGCAGCGGGCGCTCACCGCTGGCTGAGTCCGTC
ATGGACAGCGGGATGAGCTTGGAGGCGGACGCCAAATCGTAGTCCTCATCGTCCTCGTCGTCGTTCCGGGGCGTGGGGGACAGCGATAGATCCTCCATGG
CCGCGACGGGGGACGACGGAGCTTCCAGCGGCCGGTCATTCGCGTCGTCGATAGCAATGCTCGACGGCCGCGAGGTGGGCGTCGCCATGGTGTCTCCTTG
AGCTGTTCGGCAGTTGAAAGCGAAAAAGTGGTCGAGGAAATATCGCGGTTAAAAATAGACGAAACCGGTTACAGTCGGTATACTGTCTCGTGCTATCGGT
AGGCCATGTACGGTAATCGACAGGTCATTACGGTTATCGACTGCTGCTGAACCTCTTCCCGCATTTTCGGGGAAGCTCCGTGCGCCGGACTCCATTAGAC
TGTTCGGTGGCGACCCCGCCACTCGTCCGGCCAGTTCAGCGCTTCGCACGGCCAGAAGCGTGTGTCTTGATGCCGGTGCCACGCTGGCACGAGGATATGC
TCGAGGTAGCCATATTACCCCGTCTTTATCGCATGATGTATGCCGTTTGGCAGTAAATCCTATCACACAGCATACGTCATGGTCCGAACCCAGCTGGCGT
CGTCTTCTCGCTGGACATACAAACGGCAAG