Description :
From Genome Similarity Track
Location :
Scaffold_16:146009- 170976
Transcript NameFunction/comments
Phyra_76088conserved unknown protein
Phyra_76089Hypothetical protein
Phyra_76090N-acetyl-muramidase
Phyra_76091Hypothetical protein

Sequence
24967 bases(100 bases per row)
GTTAGGTATCCCCTCGGGACTATAATATGTTTCATGCATGTGCTCTTTCAGTATCATAGCCGGCATGGCATAGGAGGGTTCCCGTTTTGGTGCTTGGAAG
CGCGGAGGGCCAACGTGCAAAAATCACAGAGATGTGATGCAATAAAAGTCCGTCGTACAACAAATGTGAAACACGCTGATGACTTCCTGCTGTGGCAACC
TACCGTATCACCCGTTGCAATACCGCAGAACAGGGCACGTGACGATACCTCTCGGCATTCTTTTGTGTACGCATGCCGCAGAGAAAGAGGACGGGCCTAT
TAGGCCGCTCGCCGCCGCTGGTGGCGCGCAGTTTGCTTGCACTTGTCGCCTCTGAGCAATCGAGTCCAATCGATAGCGCGGTGAATCTGTCTGCCTCCGG
GGCCAGACATACACACCAATAGCTCTTGGACTGCTCGCCACAAGTCAGTCTCAGTTTGAGCACTCTTGCCGGAATGGTCTGGGCAGAAATGCTTTGAAGT
GTGGACGGACAGGGCGAATCTCGTTCGCTAGCTTTTGAGCGGATAGGCCCATTGAAGTCTGCGGCTCGCACCACGCGAATCTTCGCGTCAAAAATGGCCC
GACGACTTTTACAGGCGAGAGGCTGTTGCTCGGCGAGACTTGCTGGTACAAGCTTGCGTTTGGGCGGCACAAAACTTCATCCGTACGCGAGTGCAGTGCG
TGGGAAACTCTTGTCACCCAATTGCAGCTAATAAAGGGAGGATTTCCGCTCAAAATCAACTGTGAAGGTGGTATGATACAGTATTGGCCGTGATTTTGAA
ATGTAGGTGCACATGCTTAGCATTCACAAATGCTAAGCACGCTAGCAACCTGGAAACCAACACACTCGCCCAACGGAAATGAAAGCGTAAATCGAGCGAC
CGCCTATCGTTTCATGTACTTACCTAAGGTAATAGGAAGGGAAGTAACCTTCATGGTGGGGCAGGGTGTGGGGAATTGTAAACACGAACGAGAGCGAGGG
CACGAACAAGAGAGCCCACGCCTTCTCGACGACAAGTTCTCAAACAAGCGTGCCATTATTCGCGACTAGGTGCAACTTTGATTCTGTCCTCAACTTCGCA
CCACTGCCCCGAACGACTTGGGGCGATCAATAGCTGAACATGCGCTTTCGATCTGGCGGGCACGCGTCCAGCGTTTTGTCGATGGCAAGCTTTTTCGCGT
TGGTCGAATCTCGCACCGATTTCCCGTACACTTGTTTTGAGTATTCGTCGAATCTCCGAATCTTGATGGGGCTTTTCCCTTGCAGTCAATAATTTACAGC
AAAGTCTCAAAAGCGGGTGAGATTGGTCATCAAGACGACAGTAAAAATTTGCACACATACCTGGTTTTGAGACAGTGCCGAAGGAACTCACCTGATGTTC
AGTTCCTGCAAATTGTAATTGCCGCCAACATGAATCTCAACATTGAAGCACACGGCGGAAAATCGAGTTGACACCTGCATATGGCTGGGTTTTCGGGCAT
GAACACGATATTACGGCGTTTCGGAATCTCCGCCGTTCCCTCGCGCTGGTATCGTTGGCGACACGGCGCTCATCACTTCCCATTCCCGCGCCAGATCGTC
AATTCCCGCGACCATGAAGTTCGGCAAAGGCCTGCTGCAGGAAATCCTCCAGAGCAACCCGGAGTGGGCGCCCTTCTGGCTCAACTACAAAATCCTCAAG
AAGCGCATCAAGGCCGTGACCCGCGCGGCCCACCATGCCGCCAACCAGCGCGACATTTGTAAGTGCTTTCGTTTCCGGGGTTCCAGACAATCCGGATAAG
TTGCTCATCGAAATGTTTGCGCCCAACAGCCGAATCGGAGCTGGAAGTAGCCTTCTTTCGCGACCTGCAGGTCGAGCTCAAGAAGATCTCGCTCTTCTAC
GCCGCGGAGGAGAAACGCTGCTCCTTCCGCTATCACCAGCTGCGTTCCGTGCTCAAAACCCTCAAGGTTTGTAGCTAACATGTTTTGCGGTTTAAGACAC
ACCAATTCTGACGTGGGTTTCATCAGAAACGAGAGCAGATCGAGGCGTTCGAAGCTCAGCGTCTCATGTTCGCCTTCGTGCACTTTTACCGAGAGTGCAT
CCGTCTCGAGAACTTTGCCGTCATTAACTACCAGGGATTTTCCAAGGTGAGGCCAAAACGTGTTGTACCGTGTCTTTAAGAGGACATCCTATTTAACCGT
ACTGGTGACGACCTGGCCATGCAGATCTTGAAGAAGCACGACAAAATGACGGGCTACAACACGCGCTCCAAGTACATGCGCCGCAAGGTAAACCTGTCAT
CTTTCTCGAGCTACCCGACTCTGCTGCAGATCTTGGCCAGCACTGAGGACATGTTCCACGAGGTGGAGCGCGACACCCGCATGTCATCTGCCGTGTCCAG
CATCAAGCTCAACATCGAACCACAGGTGGCGACGGACGCTGACAGCACCAACGTGTTTGCGCCGGTGGTGCATGTCCCGACTGAGGCGGGAACATCGTCG
ACCCCAGTGGGGGCTAAGTCTTCGCCGTTGCCTCCCAAGTTCCTGTCCCCCCATCTCACGCCATCTAATTCATCGGCCCCTGCCCCTTCATTCCCCGCCT
CGGTGTTGTGGAATTCGGACGAGCAGGAGGCGGTTTTCCGCGCGTCGGCGCAGAAGTTCCAGCTCTAGCAAGTGCGATCCACGCAATCATATCAACGTTT
AATTTATCCACAGCAGCAGGATTGAGTGCACGGCCTGCAACGATCACCGAATTGCACGAAGTAAGAACTAAAGTACCGACTGGCGTTTTCATTTTGCAAG
ATCTTCTTGCACATGAATTAAAGTTTTCGATTTTACAACATCATGTTTACAAATAATTTTCGGCTCGACAATTTCACAATTAGCCAACATTTCCCTTTCG
AATCCGCATCCGACATAATGGCGCAGTTACTCCGAGCTGCAGGTCCGCTTGCTTCCTACGCTACAACCCCTTTCACCCAAACTAACCCGACACGATGTAT
AACAGCTAATGGCAACCTCGAGAAGGTGATCGAGTTGCGCAACGACTGGGCCTTCCAGAACAAGAAGGGCGAGTCCGGTATGATACGTCCCGACACCAAT
CTACTTATTTTGCTTCAGTATGTGCTAAAATGTGTATTTCGTAATTGTTTTTATTATATTTTAGTGCTGCACGTGGCGGTGTCCGAGGACCAATTGGAGA
TCGTGCAGCACCTCGTGTCCAATGGTGCCATGCTCAACCTGCAGGAGAAGAAGCGCCACTTCACGCCCCTGATGCTGGCGTTGGCCCAGCAGCCGCCCAG
GTTTGAGGAGATTTTCCAGGCCTTGCTCAAGGGCAAGCCGGACCTGAGTGTGCAGGATGCCTCGGGTCAAACGGTGCTGCATTTGGCGGCAGGTAAAAAG
ATGTTTTCGTAGAATTATGATTTTACGTGGAGTTAAATCGTATGATGGCTATGCAGAGTATGAGGAAGTGGAGTCATTGAAGTTGCTGCTGAAAGCAAAG
GGGAAGGTGGATGCGGTCGACAGCAAGAAAATGACGGCGCTGCATGTGGCGGTCGCCAAGGGGAACCTCGAGATCGTCCAGCTGCTGGTGGAGTCTGGCC
GCGCTACTGTTAACGTGGTGGACGTCAAAGGCAACACCCCACTGTAGGTGCACGAGGGAAGCTAGCTATTGCCACCGTGGTGCTAATACTTATGCTGGTG
TTGTAGGCACTGGGCATGTATCAAGAATGGCGGTGATCAACTGGAGCTCATCAGCTACTTGATCTCCAAGGTTCCTACTCTACATAGTAGTGGAATAACA
GTTGCTGCCAACCAGGATCTCACCTTTCGTATTGATGTGTGCAGGGCGCGAAACCCCTTAAGAACGCTCATGGAAGCACACCTCTGCACTCGGAGGCGAT
GCATTGTGACCCTACTGCAAATTGGCCTACTGCTGCTGCGGAGGTGCTGACTACTGCGTTTACGGATCTGATAGCCGAGGTCAGCAACAACGGCCTGACT
GCCCAGCAAACCTTTGAGCAAGATATCGATGCTGACGAACCTGTGGAGGACAAGTCACCGGCCAAGTCGTCGAAGAAGGGCGGACGCCGGGGAAAGGGTG
ACAACGATGAGCAGTTCCTGGAAAACACTGCTGCGGCACGTGCCGGTACGTGAAAATCGTTGCTGATGTCGAGCTTACTTTTGTCCGAGGTGTGTTTATT
AACTCTCCATATTGCAGCCGCTATTGCACACTCGAAGAAGAAGGTGTCCAAAACCGGCAAGGATGGCAACAGTGGCATGGCTCCTTACATGTGGGTCGCC
TTACTTTTTGCCATCTTAGCTGTCCTGAATGCCTTGCTTTCATCGTAGTGGCTAGGATTGCAACCAGAAATTCCTTGTTGAACGGAAGCTAATGAAGTTG
CATTTGATCACTTCAATACTTCGAAGTACTTTTGCGTCGATTTTCAAAGATTAGTGTGGTATGTTACGGCTCGATGGTGTGGGAGACAGCTATATGAAAT
TGTGTCAGCCTACCTGTATTTGTTGACTTATCTTTTCAATCACTGTCCGACGAAGAATCGTCGTCGTGGCGATCTTCTTCCCCCTCCTCCTCCTCGTCTT
CTTCCCCAACATCAGCCTCATCTTCGATAAACCGGTTGCGGCCACGGGATCGCCCAGCGATTTCAACTTCTTCCTCTGAGTCCGACTCGCCCTCGAAAGG
GTCCTCATCAACCTCGCTGTCATCCTCATCGATTTCTTCTTCAGATCCCTCCTCGCCACTGAACTCGCTGTCTTCGTTGGCGAGAAACCCCTTTAGGTTG
CCATTCTCGTCGACATCTTCCTGGTCCAAACGACTCGGGAAGTCCAATCGACCAATAAGATCCGGCAGGTCGACCAAGATCTCATCCTGGTTGCCGTCCA
AGTCGTCGAAGACGTTTGAGAGCAGCACCTGCTGAACCAAGGCAATCTTACGCTCAAGCTGCCAATGCTCACACAGCTGCTTCAGCAGACAACCAACGTC
ACGAACTGTGGACAAACTTTCAAGCAATGGGTGCATCAGTTCCATCACTTCACCATTCGATTCCATAAGTGCAAAACGACGCTCTAGTGCCGACACAAAG
GACGGGTCACGGACGCTCAAATGACCATTCTCCACAGCCGACGCCATTTTGTTCATAACCACTCCAGAGTTACCTGATCCAGCCTCAAAAATTTGCACAA
GCTGTTCTGCAGACAAGTTAATGCCCAATCCTTCGAGGAAATCAACGTTTACCAGCTCAGGGCACGTCTCGCAAAGGAAGCGGGCTGTTTTACTCTCCTT
GAAACTCCACTCTGCAGCAAACAATCGGACCAGTCGGCCAACCTCCACGAGCTCCCACCGCTCTCGGGCGGCCGAATCAATGAGACGAGTATACAATGAT
GCGTTGTGGCCATCGTTGTGGTCGATGTCAAAGTCACCACCTTCATCGCTATCTGAAGAAGATTCATCCGAGAGTTGAATAACTGGAGCCGCCACAGCTT
TTTTAGCTGGGTAGGGAGTCACCATAGCTTTATGCACTTGTTTGACGGCAACTTGAGGTTGCCGTGGTGCTTCGTGGGCAGGTAAGAACATGTCATCTTT
CTTCTTCGCGTCCTCTGCAAGAGAAGCCGCAATCGGTGTCAATTGTTTTGTCGAAGCTAGGGGCTCCTCCTCAACTGCAGCAGTGCCAATTATTTTGCTG
GTTTTCGCCTTCTTGGAGGCAACTACAGGGGCACGACCAGATGCATTTGTCGTGCTGGCGGATTGACGTTCTGGATCATCCGACACAATCAAGGTTTTTC
CTCGTCTTGGCTGCGCTGGAGCGAGCGTCTTGGGTGATACGCTGTTCAAACTCGTTGCTTCGGGTGACTTTTTCCGTTTTTTGCGAGACTTCGGTGAAGG
TGCAGGCGTATCCGATGGTGAGGTATTTTTCTTTATCAAGTCGGCGCCCGCACTCTTTGCAGTAACCGCGGGTAAATCATTTTGGACTCCCTTCGAGTTT
GATGCCGAGGATCCAGACGTATGGTTGCTGCCACAGGTAGCCTTCTCTCGAAGTTCTTTGCGTTTTTTCTTCAATTTCTTAATCTTCGTCTTGGATGGAT
GTGCATGAGGGTCGCTGCCATTGTTGCTGTCGGTAGCAGGTTGCAGAGCATCATTCTTCTTCTCAAAAGCTCCAACACTCTCCTTTGCCTTCTCCATCTT
CGAAACAGCAACGGCCTTGCGCGCCGCACTCTTCTGCTTCTTATGAGGCGGTTTGACTATCTGCTGCGTAGCAATCTCCTTCATCTTTCTCAAAGCCTGC
TCCAACGGATCCACTCCATTGTCTTCCTCATGATCTTCATCCTTCTTCATCGCATGCCACGGCGCCTGCACCGGCACCTTGGTCATTTTCACCGCCTCCA
CCGAATCCTGCTGCTTCTTCTTTTTCGTCTTCACCTTCTTCTTCTTCACGTCTTGGACAACAAGAGCAACAGTTTTCTCCTGCTTCTTAACGATGGCGTT
CGACATACCCGGCACGGTCACGACTCTCGCCCCAGCCGCCCCCTTCTTCTCCACCACTTTCTTCTTCTCCTTGGGCTTCTTCTCCTTCTTCACTTTGTTC
TTAACGAATTTCACCATTGGCACGGGCTCTCCGTCGTCCGCAAAATTCTTCTTTTGCTTCTTGTGCTTGGACTTGAACAGCACGCGGGGCGTCTCTGGGG
CCACTGCAGTTGCTTCTTCCTGCGGTAGCTCGAACATGCGCGCGTGGAAGGATGCCAGCCGCTCGCGTGCATCATCATCACCGCCTTGGAAGCTCTCGGA
GCGCTGGCGCTTGCGCTTCATCTTGGCCAGTGGAGCAATTGGCTGCGACCGTTTCGATCGTCCGAACCAGCAGCTTTTAAGCCAATGATAACGCAATATT
TATATTTCCTACCCAATCAGATGGCTAGTCCGAAAAAGGCAACTATTAACTTGGAAAATGAGACCGTCGACGCTGGCGGTGGGGCTGGTGATTTTGGCCA
CGTGCTGTGCTTTAGGCGTGTACGGGAAGCACTCGCGATACACTGAGAAATGTGGCAGGAAGACCAAGCAAGATCGTCGAGAAATGTTGCGCTCCAACCG
CCGCAGTCGCAAGGACAAACTACTCAAAGCCAAGAAGCTCGCGCGAAGTGAAGCGGTGGTTGCTGAACGGGCTGGGATGACGGAGGAACAAAAGTGCGAG
CAGCGAGAACGGATCCGCATGCAACGTGTGGAGCAATACGTGAGTTTTTTTGCAGTGAAATAGTATGTTTGAGTTGATTTGGGCACTGAACTTCGTTGTG
TTTGTGCAGCAAAAGCTGGAGGAGGCTCAGTTGAGTGGCATTCGCGTGGTGGTTGACTTGGTGTTTGCCGAAGACCAGACAACTCGAGTGAGTTTCACAT
TTGAGATCTGGTGATAAAGTTGTTGTTGTTGCTGACGAGCTGTAATGCGTTAAAGGAGCGTAACAGCATTTTCAAGCAGCTCGGGTGTGTGTACGGGTAT
CTGAAAACTTGTCCGCTAGACAGACTTCTGTCGCTGCATCTCGCCTCCTGTACGCAAAAACTTGCTGCCGTTTGCGCTCAGCACGGTGTGCTACGTTGGA
AGGTATGGATTATTGTGACCTTGTGCTGCAAACTTGTGGGCCTGACCATGCTTTGATGCAGGTCGGAAGGCACGAAGAGCCTCTCGAGCAGCTGTATGAC
GTCGGCGAACTCGTATACCTTTCACCGGACTCGGATAACGTGCTTGAAACGCTGGATCCAGGCTGCGTGTATGTCATCGGTGGCATCGTCGATCGATCAG
TTCGCAAGGTACTTAGCGTAGCCACTGAATTCTGATGATAACCTACGAATTTGCCAGCTCATCCGTGAAATTGATGGGTTTTCTACAGGGCGAGACGAAG
GCAAAAGCGGCTGCGCATGGCATTCAAACTGCACGATTGCCACTTCAAGAGCACTTTGAACAGACCGGAGCACGAGTTCGAACTCACATCATGAACCTAG
ATTCTGTGATCATTACGCTGAACGAAGTGGCAAATCATGGCGATTGGGGGCGTGCCTTTCGGAAAGCGGTGCCGCTACGGATCTCTCGCTCAAAACAAGC
TAAGAAGAATCGCGTGGAGAACGATGCTTAACTCGGGCGCTGGTGAGCGTGTGCAAATGGTGGGAACCTTAGTTAACGTGTTGATTGAAAAATAAAATAT
GAATATGCATCCTCATATCGATACAACGAGGGGTGATCTGCTCACTCTCCAACCATGGTGGCCATGCCAGCAATCACGCTTGAGACTGCAGCAGTTGCCG
TAGCTGTAGCAGTGGCGGCAGCATTGGTCCAGTTAATGCCTTGGCCAGCTCGTTGAGCTACCGTCGTATTGTCTGCATCGATAGACTGGCAGTGAGTGAT
GGCGTACACGAGTTTATCGTGCATGACTTCACGACACGAGTACGACGGCAGATCGATGGAAAAGAAACCTGCAATACAACGCCACAGCGTTAGTATGGCG
CATTCACGTACAACGTTATTGGGAAGCATAGCTTACAGGTATGAGCGATGGGCAAGTACATATCAGCACGACCCGCAGCCTTCGGGAGACCCGAAATCTT
GAAGTCCTGCGTGAAGTCTGCTGCATGTGTAGGCAAACGCGACCGACCCCTGTAATAGGTAAACAGAACAACAGATTAGTGCACTGAATAACCAAACCAA
ACTTAAATCTGGTGGCTCTTACCAGACGAAGCGAAGGAACGATGATTTCTGCTCGGCGGTGAATTCTGCCAAGATGTCCCAGAAGTAGGCAATATGCGGG
TCTGTTGCTAGACAGCCGTCGCCGTATATGGTTCGCCGCCGTAGAAGAGCAATATCTACGGAGGCTTTGCCGCACACGAGTGTCCGCAACTCATGCCACG
AGAATAGCCCCAGAGTAGGTGCTGGTAGAATCGTTGCTATACCACGCGAAATGTCCCCACATACTGGCGCGAACTCAGTAAGACGGTATGTCTCGACTGC
TGATGCGTACTCCTCACGATCTTCCCACGTAACGTGCAAATGCTGTCCCCCAGGCACTAACTCAACTGTCTCCCGCGTACTGGATAGCACAGTAAAACTT
GCATCCACGATCTCATCGAACATAGTCTCCGTAATGCCGTGTGCATCCAAGTTCGCAATCGTGTCCACAACCTGAAAGCATCCCTGATGGACAGCTTCAA
TATCGTGTCGTGTTACATTCTGCCCTACCAATAGTTTCCACACCACGGGCGGAAGATTCAGATCCAATGGTGTTTTAGTTCGCACAGCCACTCCTGCAAG
TTTGCCGAGGAACTCGGCCATCTGCACCCGTCGCGGGTTTGAGCGTAAGTGTGAGTTTGGAACGAAAAGCTCACGGTTTTCGCCCGTGTTCAGCAATGCG
TTGGGACACTGTCGAAGTACAGGCAGCAATGGCGTACGGGTTTGCAACTCGGAGCTCAGCTGTGCCAAACACTCGCGGTACAGACCGCCGAAATCGTCTC
CAAATTCGCCGACAAACTGGCACTTGAATGCACGGTCAGCCCCACGTAATAGAGCAGGTTGCAGTCCGTGAAGTTGCTCGAAAGTCTGGGCGAACACACT
ATCCCGCTCACCAGCTTCGCTAGACAGCGGATCACCACGCTCCGATAGTTCCAGTGCATCATGAGCACGGTTGCGATCGACTTCAATCTCTGGACGAGCT
GCTGCTGGAGCTTGCTGCTCTTTGAGGACTCCGAGCCACCACGCAAGCTTCACGTGCTGAAAGACCACACCACGAAGCTCTCGAGCCCCACGAGCTAGCA
ATGAGTGCTCATCCTGGGCTGAGAAGTCGATAAATGCCAGTGATGTCTGCAAACGGCAGTTGAAGTTACGTAACACCAAAAATCGGCGTTGGAGTGTCTC
CAAGGGTACGCCTCGCAGTACCGGGAATCCCTGTAGTTGCTCTTCGGTTGGAACAAACTCCTCGGGAGCCATACGCAGTGGGTCACAGCTTAATAGCGCC
TCGGCACGAGTCTCGCATATTTCGTTTACGAGCTGCACAAGAGCGCGATCCCGGGCTGGGGTAAATACACGCTGGGATGCGTGCAGGTGGCGAAGCTTAT
CACCGTACTTGGTCGCTAGTAGCCGGCGGCCTGTTACTGAGAATTCTGGGACGGCAGTGAATGCAACACCCCACTTGGTGTCTCCGGACGACTGCTGTTC
CTGCTGTTGCTGCAATAAACTCGTCACATCACCAGTAACAACCTCTTCAGCGGATCGAACCGCGTCAGTATCTCCCTGAGCAGGGGGCGGAGGTGGAATT
GTGCTTGAATCCAATGCTTCATTTTCTAAGTCCTCAGACAGCGATAAGGATTGATCATGCAGTAATTGACGGTGCCGTGCGCGGCGTGCCATTGCTTCTG
CTTCTTCGCGAACGAGTGCCTCCATTGCGTGCATGTTCGCCAGAATGAAGTCAGCAGCCTGCTCTGCATCGTCTTCACAGTGGCGGAGCGCGTAGACGCA
CCATTCCATAGGGAACCCCATTTGGCTCAACGCAATTCCCAATTCCATTCGGAAGTTTGGAATTGAGCCATCACCCAGGCTTCCTTCGCCAGCAAATCCA
CCGAGAGTGTCTTCTTCTTCTTCACTGTAGTAGGAATCCTCCCCACTCACCAGTCCGCTACCGGTTCGAGGTAGTCCCGGTTCAAGACCCCCATCCTCGA
CTCGGTGTCCACCGATAAGATCGATGGAGTCTCGCTGGTTGTACAATGCAAATCCAGGGTAAAACGTACCCTCAAGTTTAGGCCCAGTTCCACCAGGACC
AAACGCAACACCCAAGTCCTTTCCATTGAGTGCGTAGCTAAGCGTACCGCGCCGCAAATCAAGCGTGAGGCGGACAATATCTCCAGTCTTAAATTTGTCG
CCGTATGTACCACGCTGCTTGCTGCCATTGTGCCAAAGCGCACGATTGCCAATCCAGCCCCACCCGCGGTTATCTTTGCCCAAGTAGGAGTCTAAGCGTA
CGTCGCGACGAGCAATCCCCAAGAAGATATTTGAGCTTGCTGTCACAAACGTAATGCGTACTTCCCAAATGTGCACACCTCCATCAAAACGCGCCACACC
AATACCTGTTTGCCAGCCTTTATCACGTGCGAGAGAGAGCCGAGTGTCTCGTGCTTCAAGCTTAAGATATGGGCCTTTACGCACACGATCCACACGACAC
TGGAAATTAGACTGCACGGGGAACCGCCACACAAAACTGTCTCCATCGATGGTGACTTCCTGCCCTCCGCAGGCCCCTGTAAATGCACGCACTTCTGCTT
CGCCTCCTCCGCTGCCTTCAGTGCCTCCTTCACTTCCAGCAGCATTTCCACCCTGCAGGATCTGCAAGCAATGAGAGCTAGCTGTCTCACTCTGAGGGTC
TAACCGCACGCGAATACTGGTAGCAAGCGGGATACTGACGAGTGACTCTTGTAGGTCGAGATCGTATGGATGTGCACTCTCTACGCGAATACACACATCC
TCTGAAATGTCTGACAAGAAATTGTCAGCCGAAAGCATAAATTCATCGGGTAACTGAGCCTCAATGGCAGGGTCACTTGGTGTCCCTGTCTTCTCACCAT
CAGCGTTCACTTCATCAGACCTCGCGGGATCCATTAGCGCTTTCATCACGCCATAAACTTGACTCAGAGGCTCAAACCACTCGAAAGCACTCATAAGATT
ATCACAGTCAAGCGAGTGGAAGCGGAAACTGAAGTTCGCGTTCTTCACTGAAGCTGTCGCTGTGGCACCCAGGTTGGCGAGCAATTTGCAGTCTGCGTTG
AAAGAAATGGTAGGGTGTAGCAGTTGTGGTCGTGAAATACTCGAGAATGCAGTACCCAGCAGCTGGCCATTCTTGCAGAAGAAAAGCTCTTGAGTATCTA
GGCGCAAACCACAGCCAAAAACATCACCAGGGCTTACAGCACCTGCAGGTTCAACCCAGCGCCAGCGATCCACAAGAGTGTCACCAGCACACAACGCTTG
GCCGTTTGCTGGAGCAAAAGAGTAAGATCGAGAGCCGTCAGCACTGCCGCCCACCAATACTCCTTCAAGTGGGAACGACGGTGGTGAGAAACCCAGCGCG
AGCGAGCCTCCCATTGTAGTGCTTGTGCCCCACTCCACGACTGTGACTTCGAAATACACAATTTCGGCTTTTACCTCATCTCGCATTGTCATCATGAGAG
CTGGGGTATGTTCGAAGCGGCAAGAGTACACCTCTCCGGGAGGAACACCAAGTCCTTCAGCTGCCAACGCTTCTCTCGCCGCCGTGTTGCCGCTGTCTTC
TGCGCGATAGTCTAGCAAGAATTTACGCTCTTCGCCAGATAAATGACGACTGACCGCCATTTTGGAAGAATGGCTCACCAGCATCTCCACGAAAGGCTGT
TTGGAAAAATGGAATCGGTACGGTAGGCTCAACGAGCCCCCTCCATCTCGTTCTAAACAAGCGGCGAGCTCTTGTATACGCACACCGCGTTGCTGATCCT
CGACAGCAAGCATCAACTCTACAAACGCCTGCAAAAGAGCATGTAACGTAAATCCGCCGTCTTGGTCTTGGCTCAAAGCCATAATCTTGGAGCGACAATA
AAGTAGAGCTTGCTTGTCATACCAGTGTGCACCACGCTGGATCACCGTAATGAGACCTCGTACAAGTGCGACTGCAGCCTGCCCACTAGACGGCTGGTTT
TCACGCAGAACTTGCTGTACGAGAGTAAACAGAGCCGCCGGCAGTTCGGGGCGTAACCGTATTGAAGTATTTTGTTTCGCCGGCTTGCTAGATAGCACCC
GCTGATATTGCAGTAGCAGCTCGAGGAAGGCGAGCACATGGTCCACACTTATTGGTGCACACAGAACCAAGTCTTCATCTGAGAGACTCACCGCGAACGC
CGTGCTGGGTTCAGCAGCGCTAGTGTCATTCAGTGTAACAACCGGTAGAAGCAAACCAGTGCTAAACTCCGACTCCACTGCCCAAAGAGACGTTTGAACA
ACAACGTCGTCAGCAACGGGCAGCATTAGCTGCATTCGAGAAGAATCAATCGCCTGGTTCTTGGTGTTACGACTATGTGGGGTCGGACCATTCTCGCCGG
TGGCATCTTCTTCGTCTTGAGCTTCATTCTCGACTTCAATCGTCGTCGGAAGCTCAACACCTCCACCCCCTGTGGAAGCAGGTGAAGCTGCACGCCAAAC
ACAGTGAAACGAATTAACACGTTTCACAAGGTCTTCGCGAATACAACGTGTGCTGGAGACATCTGGAGGCTCAAAAGGGTCTTCCTTGCTTCCTGCTACG
CATCCTAATGCTACGTACCCAGCTGGTGCAACAGGCCACCAGATAGAGCGCAGCTGCTTGCGTTGAAAATCCGGATCACTTTCGGAGTTCTTAGGCAAGC
CTTTTCCAGTAATATCCACACGCTCAAAGCTTGTAGGTGGGGCCAAAAACTCTTGCTCATCGTTATCGTAAATCAGTAGCATTGGTGCATCAGGAGCACC
GTTACCACACTTCACCACATCGCCAAGGCAGAACCATTTATTGGTAGTGTCCGATGCAGCCTCCGGCACTGGAGGTAGCGTCGGACGCCAAATTGTCACT
GCATGATCTGCAGCAGACTTCATCCAGCTATTGTCACTGCCGAGTGAAGACGCGAAGCGTTTTCTCCACTTGTGGCGATACTTTAGTAGTGGGTCAGGTG
GTGGAATACTCCACAAGCGCTCGTATGTGTCAACCACCATGACTTCAAGGCCGCAAGAAAGCAGCACAGGTCCCTTCGGGAAGCACCCGTCCGTTTTCCG
ATTTCGAAGAGGCGAACTTTCCCACCCCAGTGCAGTGGCTGGTGTCGCATGCGTACGCGAAAGAACATGCAAGATCGTTTCGAACGTGATTGCATCCAGT
GTGTTGGGCTGGTACAAGTCATTGACATCCTCTCCAGCGTCGACCCTGTTCTGATCATTCTCAACAAGGGATTCAACAAGCTGAGTAATGCCAGACCAGC
CTAGTTTTGCAGGGTGTTCCATGACTTGGTCGATTGATCGCTGCACAGTTGACAAATTTTGTGAAGAGAGCAGGTTTGATACCAAAGTTTCTGTTGGAGA
GCGTGCCATCACTTCGCGCACCATGCGCGATAGGATCTGCTGAATCTTGCCGTTCTTTTGCGCCTTCGGTTGTTGATGCAACTGATACTCTGTTTCGTGC
TGCAAATTCAAACTCGCTTGATGGGGAACGCTCAAAAGCGTAATCAATCGCCGAAGTACCAAAGGATTCCCAAGATCACTGAGAGGTGCGTCTCCGGTCT
GTGAGGCATTTCCGAAGAGCCGTACAATCTGGACAAGAATTGTGCGTGCATGAATAGCTGCGAGGCGCTCACATAGTATCTCTTCTTCACGATCGATCTC
AAACGCGTTCATTTGTCGTACCGCATCGTCAAAACTGCTGTTGCATTCGCTCCAGAGCGTTAACTCTGATTTGCTGAGCATCAATTCCAAACCGGCACCA
CCAGCGTTATCCATCTTTTTGGTTTTAACAGGACTTCCCATCGCTCTGCTAGCAGCACGGGGAGGCACAGGAGGGCACAGTGCACTGGATTCTGTGAGAG
CGTAGCTTGGGTTTTCGTCTCCGATGTCCTGAAAGTTTACCAGCGGCTCACTAGGCTGTTCCGCAAGTAGGGTGGCATCCGTTGTAGTGAGAGATCTGGG
CGATGACACTGAATTTTCCAGTTCTGCACTTCGGCTTGAAAGTAGTAAGCGTAAAGCATCGCCGTAGCTGTTATCTGTTTGGCGTAGAGCTTCAGCGCAC
ACTGACTCAGATCGACCAATAACCATTGCTAAGTGGCGCACGTTTGAAGGGTAGCCACGCTGTGCGGTGTTGCAAAGTTATAAAAGTAAACGTTAGACCT
ATCATCATATGCACTTCTCGCAAAAATACTATAACAGATACTTACCAAGTGAAGCCCACGACTTTGCTGAATCACTGCAAATGCTTCATCCAAGACACCA
GCCGACATGCGAAGAGCTTCTTCGCACTCAATCGCAGTGGTCACTAGGTTGGCTTCTTGAACCCGTGCAAGAAGCCGAAGTGTAAGTACTTGCACGTCCT
GTAGGCCTGATGCCGCATTCTGTTAACACGATGACAAATCGTTAAATTAAGTGCTCGCATGATGGCAAATGTGTGAAGAATGGAAACGTACTGAAGGTGC
AGCCAAGCCTGTGTCACCGTTGGAGCGTAGAACGCGTGTCTTCGCCAACTCAATAGGAATACTAGGGCGCTGTAACGATGACTCACGGTTTACGCTGTCG
CGGCCTAATGCGATACGAAGCATGGATCCCACCCCGCCTTCCTGGGCTCGAGGCGATGGGATAGCGGTGGGCTCATTCGGAGCGAAACTTTCGCGCTGCT
GGTAAGATGCCGGAGACAAGATGCCTGCTGGTACCATTGTGGAGTACATATTTGCTGTTGGGGGTCCTACCGTAGGTGTACCTGGGGCTTGTAACAACGA
AGAGCGTGGGGATGTGTAGCCACCAGCTCGAGGTGAATCCACAGCAGGATTTGGTGAAATGAGTGCACGAGGGACATCACTCTCAGCAACAGACGTTATT
AAACGAAGCCCCTGGGTTATCGCCTGACGAGTCTCCGCTGAGGTGGTATTTCCACGAGTCCCGCGATTCTGCAACTCCGCTGGGCTTCTCGATACTACCT
GTGGTGTACCAAGTTGTGGCTGTTGATACTCCTGGCCGGGGATCAAAATGTTCAGATCACCTGGGTTCTGTGGCGCAGTGACGATAGGAGGCGGTGCGTG
GCGACCTCCGATACTACTTCCAGGGGCTCGAACCTGGAATTCATAAGTCACAAGACCACCTCGAGATAAAATCAAGGATATCCGGGACCCCGACGTGATC
CGAGTGCTGGATCCATGAATACGCACACCATTTACAATAGTACCGTTCTTGCTGAAGTCTTGAAGCTCAAATTGCTCTTCACCTCCTTCCATTTCCCGCC
GTAATCGACGCAAATGGAAGTGGCGACCACTTACACTGCGATCGTTTACAATGAGATCACAAGCATCCGCGGCGCGACCAACCCGTATTATAGGAGCCGT
TAGTGGAAACGGTGCATAATCGATGGCCGAATGCCCAGCAGCACCAACAGCATGTCCGTGCTCATTTTCACTCAATGGTGGCAGGGGAAGTAGTACACCC
CATGCCCCAAATGGAAGATCACCATCTCCTGATCTGTTGGGCCGCTGTGCAGCCCCACGCAATGCGCTCGATCCGAAACCAATTGGAGCAGCACCCGCAA
ATGAGGGGTGACTTATCTTACGGCGCGGTGACTGTATGGCATCTATTCCCCAGCTTAAAGCATTTTCGCTCCCCAATTTTCGAATAACTTCGTCGCGCAT
TTCATCTTCGTAATGATCCAAAGCAACATCGATCACCTCCTCAGTATCCAAGAATATTTGTCGCTGCTTTACGCATAGCCATCGTTTTTGGAGAGCGCGT
GCTGTTTCAAGCACTACTACGTCTGACTTTCCTGCCCACGACATCGAGTTCTCAGAGGAAAGCAACGTGACCACGCTCGTTACGAGCTGTGAGTCCAAAC
TCATTAACGTAGGGCTTAGAGTTGTAATCTGCTTCAATAAGGATGACAACGCCTTTGATGACCTCCATCGCATTTGCTGTTTGTACATCTTGAGTCGTCC
CCTCAATATTTTCTGCACCGAACTGTTCTGGGGAAGTGACAAATCGTAGTGCATAGTACCCTCTTCATCAAAACAAGAAAGTGAAGAAACCATCTCCGAT
AGCGTCGTGATAATGCTTTCTACATCATCGAACATGTCCACAAGAGCTGGGATGCGCTCGACTACCTGGAGCTTGGAGAGTGGGAATGTCTGAGTTCGTG
TATCTGGTGCAATCAACGGAGAAATGGAGTTTTCAGGACTGGAATCCACAACTACATCTGCTAAGAGATCTGCTGTGCGTGGATCTCTCGTGATTCCGGA
GAGGACGCCCGCCCTGCTCGAACCTTGGTCCCCGGCGCCTTCAATGGTGACGGATCCGCTTTCTCTGAACATTTCAATGTGTCCACCAACAATGCTCACT
GCCGCAAAAACTGTAGCCAAACCCTCAAGTGCATCTTTGGCCTTTTGCCAGAGCATTAGCGAATGCTTATCTCGAGTAATTGTCTGTGCTTTCTCCGTGT
CATTAATCGAGTCGTCGGTTTCTGGCGACGAAGTAGTCGACTCGGGTTTTCTTAGACCCGTGGAATCATTCTCTTCCTGGAGGCCATCAAGCACTGCGGT
TTGTAGAGTCGTGGTGTCTGCTTCCTGGATATTTGTGTAATATGCACAAATGGTGTCCAGCAGCTCGCATACCTTATCTGATTTCGTAAGCCCTCGGTTG
ATGGCGGCATTGATCGCGACTTTCCAGGCTGGATACAGCGTAAGATAGCGCAGAAGTGCGACGGCCTCGGAAGCCTTCGCTTCTGCAACGTGAGCTTTCT
CGAGTGCAGTTTGCTGAATTTGACTAACCTCAGTATCATTCGCTATACAAATTCCCTTCAAACACCGTGCTGACTGGCAAAGAGCAGTATTTGAACACTC
CAAGCCAAGTTCATGGGAGCAAAGACGAGGCCGGAGCAGGAGAGGAAGGCCCACTAACCCCATCAGCATACTTAGAATATCCCCTGAGAGGATGGGGGCA
GCCTGCTGGGAACGGTAAATCTTGTTGAGCGCTGATACAGAATGCTGCGGGAATACTAGCATCGCCAGGCGAATACATATAGTTGCGGAAGCCAAGTCGG
AGGAGTTCATTCCACTAATGATGTGGGTAGTCACCTCGGAGTTGGCTGCAACTATCGAACCTACATCAGTATTTGCCGAACCACACGCGAGAAGCACACT
TAATATCTGGTTCCTGTAAAAGTGGGCGTGGAGCGAATTGAAATCCACTCCCGTGAGAATCCCCGAGTCTGGCGAAGATAACGTAAACTTGGAACCAAAA
TACTGCAGTAGCCCAACGCACACTCGTTTGAGAGATACGCTAGTGCCCAGCAAGCTAGGCCCTGTAGCCGTTGTAATCCCACTTGTGGCAACATAACCGG
CATCATCAACTTGCAGAAACTGCAGGTTTTCCAGCAAAAAGCGTATGAACGTGGATAGCACTGGATTCACACGATTGCTTGCTGGTGCTAGGTGGCGTTT
AGCTCTTTCGCCAGCATCTTGAAGGGATCGATACATTAAAGCGCGAGCCATAGCCCAACCAGCAGCGTGTAACTTCACCAATGGAAGCTTGCGTTGTGGG
TAGCCACGTTTGATCTGGAGCGGTGCACGCTTAATAGCCGTAGAATCAACGGCGTACTTGGAGTCGATCTCCTTCATTAGCGACTCAAATAGAGCATCTG
AATTCACTAAGCAGCTATTTTCTGGAAGATCTTTTGCTTGGCTCGCGTCATCGGATATTCCATCAAGTTCACGGCTCTCACCAGAACGACCGGTGAGAAT
GTATGAGCTGTAGAACCCGGCCGCTATACGAACGACTTCATCGTTCGCGAGCGAATTAGAAGGTACGGGCAACGGGAGATCTGCAGAAGGAAGAGTTCTC
GATCCTGCTCCAAGTTGACCCTTGTTGTTACGCCCGAACACCATAACCCGTCCGTTTGACATTAGAATAAGCGTATGGTAGCACCCACATGACGCGACCT
TGATTTTGGAGGACAAAGGTAGTGGTACATACTGTGCACTATTCTTGTGGTCCTTGCTTCCAATTCCCAACTGTCCATAGTCATTCCGCCCCCAAGTTAT
GAGCTTGCCTTTTTCGCTGATCGTCACAGTGTGATAGTATCCACAGCTCACCGCAACGATCTTTTCATCGCTTTCTCCAAGTGATGTTTTAGCCAGAGTC
GGTACCTTCATGTTTCGTGCATGACCCAGGCCAAGCTGTCCGTAGTCATTCTTTCCGAATGAGTATACCTCACCACCACTAGTAATTGCGACGGTATGAT
ATAGTCCACACGCCACCTTGATGACCATTTGACTCGATAAGCCATCCACTAATTGCGGAGTGTGCTGGTGCTGGGTATGGTCAAGGCCCAATTGTCCACA
GTCATTCATACCAAACATCAGCAATTCACCGTTGCTCGATACAATTGCACTATGATGATAACTGACGGCGGCAGTCGTAATATGATACTTTTCACGGACA
CTGTCGATCATGCGGGGCGTATGGCTCTTTGAAATTGTAGAGCCAAGGCCTAATTGGCCCCTGTCGTTGTATCCCCATGAATACACAGCACCGTCTGCAG
CCACAGCTAGCATGTGCTCACATCCATTCGCTGCAGCGACCATATTAATAGCAATCCCGCTTAGTGCACGAACAGGAGTAGCGATGATAACCCTCTCCTC
AAATGTTCCATTGCCGCATTGGCCACTCTTGTTAAGTCCACACGTGTAAACTGCACCATCCTTCATGACTACAGCGAGGACTTCATTTCCTCCAGCAACA
TCACGAACAGCCTTTGCAGAAAAGAATGGTACATGCTCCAGCTTGCTCGTTGAGTTACAGTGTCCTAAGCAAAGTTCTCCGTAGTTGTTTTGCCCACATG
CAAACAATTCACAGTCATCAAAGCTGGCCACACCCGACAGTCTTTCCGACGTACCAGTTTGTCCTGATGCGGTTACTCCTATATTTTCATCTCCGAGCGC
AGCGTTTGGCGATTTGGATCGATTTAATACGTCACCGAGTGTTGCGATTTTGTCATTCCATGACCTTCGTGGTGGGCAAAGAAGAGTGTTTTCCATCTGA
TCATCTTGAGATTCACCGGAAGTGTAGACGTAATAGGCTGAATCAAGATCCCCTCGGTTGTCGTCATAACATGCAGCGCACAGCTTGACACTGTCATCAT
CTCTCTGTCCATAGTATACCCCACACAGCGGCATTCTCTTACACTCCTCGCAACAATAGGACCCTGTCGTGCTTTCGTTGTATGCAGGGCCATTGTCGCG
GTCAAAAATGCCGCATAATCCAATGAACCCGATGTCGATGTTTGAACCAGACGCCGGGCAAACTGCCTTTACGAGAACATATCGACCAGTGACAGGGTAG
GCCAACTGTCTTGAAATCTGAGCACAATTACCATCTAGTACGAAGAACGCAACAGGCATACGTTCATCTCGGGGGCAATGTCCACTGCTTGGGGGGAAAG
GCAAGGCTGCAAAGTCTTCAGCGGTCATGTCGTCAAACTCCTGATAGCAAGTTAGATCAGGAGGACTACTAGTCACAAATACTACAGCACAACGCAGAGG
GCTAGAGTAACCAGGTCCAGGCCCTCGAACGCTGATGTAGCTCACACACATAGGAGTGTCAACTTCATGCTTCAGCACCAGATTGACATTGGTTCCCTTC
GCTGAGCTGTACACCGTCGTATCGTCCAAAAGACAATTTCGAGAAGAATGAGAGCTACTAAACTCGCCACCGTCGCAGGAATGCACTTGTAGTTGCAAGC
TCTTTCCTAGTTGCAGCTCATTTGATGAAGAGATTTGCTGATTCTGGAATTTCGTGGCGGGGGAGAATGCGTGTGAAGGTAACTCAAGGCGGGGGCGGGG
GTGAAAATTAACGTCAAAGACAGTGCCATTGCAGAGTGCTGATACCGCAGGGAACATGGGCTTGCTATGAGTAGCAAGGTTGAAGTGGCACACATCAGGT
TCCGAGTGATCAGAGAAGAGTGTGACGGTGGCTTTTTCGAAATCAAACAGAATGCCAAATATTCCGCCTTCTAACACGTCTTCTGGGCTATTCCATTTCA
CGTCAAGCTTGCTGTGCCTCAGTGGCATATCCAACTCAGAAAAATCATTGCCAACAACCCCACAACTGAGGGCTGACCGTCCATCTCTTCCAGCCGAAAC
AACGCGAATTTCAATGAAAAGACTCCCGTTTTCGAAACCCTGGTTGGCCACAATTGTCTCGAATTGGTCCTCGGATGAGCTACAGTCACCGGCAACCACT
GTGGATCCATTTTGCATGAGTTGAAGCCGGTCACCTTTGAGCTTTCCGTTCCAACTGATTGTTGCCCCATCAAAAGGAATTGCGACGAGACCTCCGGAAA
CAACTGGGTTAGAAAACTGAAAATTGGTGCTGGCGCACCACAGTTTTGACGGAACTGGGGGTGCAAGGTTCCAGTGTACGTCTGCATTCTTGACACCGAT
CGAAGAGAAATAACCGCAACCAGTTATACCTGTCATGGTTAGAGAAGCAGTGTAGCACCTCCTCGAACCGATGTAGAACTCTATCTGCCTTTCCTCGCAA
TTCAATAGCACGCCAAGCACATCGGTGCGATTCCATCGAATTCCGGCAATACCGAGCATTTCCCCACTAATTCCCTCGCGATGGAGGTACACTCCGCAGA
GATGAGCCTCACCAGGAGTGTATGTATTAAGATCTGCCGTACCAAGGGTAACGCCAACAAAGACAGGAGTATCTCCAACTGCACGCACCGACACTTCCCA
ATACCACCGCCCTCTGTAGAACAATTTGTCAAAAACGGCAAGTCCCCCGTTTTCACTGGTAGTAGGTGGGGTTTGCGCGCTCTCGTCATTTGCATCAAGA
CTTTTATGCGTAATCGTAAGTTTACGAAGATCCGTGCCGAGAGTAATGTACCGAGAGCAGATAATATTTGGGTACTTTGATCCAGTGGAAGCAGGTAAAA
TAGCGTACTTCTCGGTACTTTCAACATCGATCGGCGAGCTGTCTGACGCATCGTACTGGATAAATTTTTGCCACCCCTTCCAACCGATTAGCTCTGTCAT
CAAGGGTATCAAATTTGTACGTTGAAGTTGGTCCCAGTCTTGGCCCTTGTAGGGAAAGCAGCAAATTTCCAGTACAAGTAGCATATCGTGCACAGCAACC
TGAACGGTAGACGACGACGATTTCATTTCACTGGGCGCATTATCCACTCCGCTTTCAATAAGCTGCTGGACTTGGCGCAGATGTTCTGTGGATGCCTTGA
GAAGGAATGTCTGTAGTTCGAAAAATTCTTGCCCTATGTCCTCGGATAGCTGAGGTCCAGCAAACTCAAGGTCAACAAGGTAATGCACTTTGACGGTTGA
GTTTTGAGGTGCCGATAGGTTCCCCGAGTTTTGGCCACTGTTAACACGAACCCGCTTAAATGCTGAAGACAGCATCGGAATAACGTGGAAACGCGAGGTC
GGTATAGTTTCCGTGCACTGGAGTAGTCGAACGAACGTCTTCAGGCCTTGCAGGCGCTTTTTAGCGCGATTTTGATGTGCCAGCAAGATGTCTCGCATTT
GGTCTTCTGGGTACCGTGATGACGTCTCGTTCTCTTTACTGGAAGTAATCAGGCAGCTGCTTGACTGCTGAATGAACGCAAAAATGTCCGCATGGACCTG
CTCGTCTTCCTCTTCCATTACTTCCATCGACTTTGTTTCCATCAGTCTGTTCAGCTGACGGGTAAAGCGTTTTTGCTCAGGCTCTTCCGGGTTAGCCTCC
ATCGGCTCTGTTTGGTCCACTTTCGCGAAATCTGCAATTGTAAAGTTCGTAAATAACACCAAGTGAAAATGACTAATATAAAAGTATAGTCCTTACCATA
GGTCGTTGCGATCGAGATTCCGGGGAGGAGCTTCATTGGAGATGATGCTGATGGAGCGCATTGGATTGGGGCAGGTGCTAACTGAAGAAGCAGCTGTGCT
CGACGAATCACAGGCTCGCAAACAGCATTGTATAGTGCTTGCTGTCTTTCCTTCGCCTCCATATCTGGAGAAAACCCGTTTGGTGCACCCGTCTCACTGC
AATACAAGCAACAATTCTTAGAATCAACATTTCTGGCACGGAGTACGCAAATCAGCTACCTGAAAGCAGCAGCCAATTTCTGTTGCTCTCGTACGATCCT
GATCACAACGAACAATCACTGATGTTAGTCTTCAAAGGAGAGCGAGAACAATTAAATATTCAAACCTTACCAGCGGCGAAGCTGAAGCGCAGCCTTCCAG
GCATCAACTACCGCATCTGCCAGTGCGCCATCGTTTGAAATAGGTTCCGTTGTGTAGGAGATATTGGTGTGTTTCAAAAGAGCCGCGAACGTAGCACGCA
CTGCTCGGTCCACTGCCTCGATTCCACCACTCTTTTCCAGTGTCGCTTCAACGCTATCTTGCCTTTTCAGCCTTGCAATTCGTAGCTGTGGATGTGTGCC
ACCTGGAGCCGAACCGGGATCTAGAGCATTTCGAACTTTATCCAAAAGCTTTTTACCACTACCAACGTTCTCCATCACTTGCTGAAGAAGCGTTTCATTT
CGAGCCACACCACTATCAAAGTTTGCATCGAGATTAACTTCTTCCAATCCACCACGAAACAGGGGAGAGTACAACCACCGTTCACTAACAGCTACACCGT
CATCTAATTCACCACCGACAATCAACGTTGCAGCGTAATGACTTCCAACCCAAATTAGTACTTGTTGAAGGTCCTCTAGCCACTCGTGGCTTTCGTCAAT
GGTTTTACCGGAGCACTGCGCCATCGATGGAACGGGCTTTGAGAGTGAGTATGGTGCTGGGGGTGGTCCCACGTTGTCCTCAGTTTTTTCTGGGGTAGGT
ACAAATCGCCCACTCATAGGGTATATGTGTTGCGAGAGAATTGTCCGACTGGGAACAAACGAAACTTTCTGTGGATCATATTCAAAAATTCCTGCCTCGA
CCCTGGTCTTTTGAATTTTAACCAACAGTGCGTCTGTCCCAAAAAGCTTTGAAAGCTCCGAAGGAATAGTCAGCCTGCGAATCTCGGCGTCGTGGGGCAA
ATCTTTAACTTTCCAGTATGTGAAACCCTTAGAGTGAATGATCTTCTCCCACAAGCTCTTAAAAATTCGCCCATACGTGACTGATGAGCCACTACTCTGG
TGAAGTAGGTATGATGAGAGCTCTTTCGAGACGGTTGCAAGCGCATTATCCTCGGAATCAACTTCTACTTCATTTTTTTTCAAGGCAGCTGGTGATTCAA
CACCAACAATTGGTGGACGCAAAATACCTCGTTTGCTTAGCAGTACAAGTGCGATATGAGTTTTGCTCGATAAAACTTCCAAGTGAGACCAAAATGGGCT
TAGTATATCAGGAAGTGCATCGCGAACGGATGGTAACGAAAGCACGCTCAGCAACATAAACGGCAGTAATTTACCAGCAAAACTATGCTGAATGAAGATG
GGGAGAAACCGGCTCTGCTCTAGGCGCATTGTTTCACAACGATCCAGATACTCCGAGATAAATGACACCAACTTCGTGCAGACAGATTCAATTATAACCC
AGGTTTGCTTGGTAGAGCATGAACACCAAAATATAGTTGCGCGAACCATAATGTTCAGACACTTGAATTCGTGGCTAGTTTCAAGAGCGTCTAGCTGATT
GATGAGAGCAGTTGCATCTTCTGGTGAGCACTCCACCACTTCCTTCGTTTGCTCCCATAGAGCATCCAATAGTGTGCCCATGAATGTGATTACAGTGTTT
GAAACTACAGCTTCCTCAGAACTGTCCACCTTCAACACCTCCTCAGGGTCACTCATCAATTCAAATAACATTTTCCCTGACGTGAAGCAGGGTACAAGCA
TCGGAATCAATAATTTCTGTGCTGGGGTTGGTTCTGCGTCCGAGTTGTGCTTATTTACCATCAAGCGGTTCATCACATTTAACCTGTCCAAAAGGGACGG
AAACAGCGTTGGGAATCCGTAGTGGATTGTCGATGCTGTTTCTTGCTTCACCGCATGGTAAAACCACAGTACTTCTCCTGACATCGATACTTTTGGTACG
TGATCTGCAATCGAAAAAAGTAACTCACGAATTGAGTAAAGAATCCCTCCAGGTTGAGATGCTGCAGCTGGCAATCCAACCTCTGACCCGTCCAAGCAGC
TTCGCGAAAACTACCAATTAGAAGGGTTTTGACAAGGTGAGTAAACAAGACGGCAACCAATAATAAA