Description :
From Genome Similarity Track
Location :
contig_51:146005- 147269
Transcript NameFunction/comments
g10583.t1hypothetical protein

Sequence
1264 bases(100 bases per row)
AAAGATCTCTCTGTACACGATATTGTTGGTGTGTACTCTCCCGTCCTCGTCTATGGCCTCTGGGCCAACAGCAATTTTGATAGCCTTCCTCGAAGTCACT
CTGGACAGCGCCACATGCAGTTGCCCATGTGCGAACACGGGTGTTTCCAGGTAAATTCCAACATGGTGGATCGACTGCCCTGGGCCTTGTTGATCGTCAT
TGCAAAGGTTGGAACGACGGAGAACTACTTACGCTTCATCTTGAACGGGAGCTCGTTGTCATCGTCCTCAGTGTAAAAGATGATTCTGGGGATGAAGACT
TTCGAGCCCTTAGAAGGTCCGGACATTACACATGCTTCGATATTTCGCTCACGTAGTGACACCACACGTAATCGAGTCCCGCTGCACAGTCCTGCATCAC
TGTTCAGGCTGCGGATCATAATGATCGGCGTACCCACTTTCAAAACAATCGTGTGAGGTGGAATGCCGGAGAAGTTGAGCGAGTTAAAAAAACTCCTGCT
CAAACATGTTCGGGTCCGCAATGCCCTCGAGACTCAATCGAGAAATACGCTCTTGTAGCCCCTGTGAGTCGCTCAGCCACCATATCATTGATGCGCCTTA
CGCTGGCGTTGGTCGGCGCCAGAATCGCCCGTTCAACAAAGTACTCGTATGGCAGGTCATCGGCTCCAAGACCCGGATATACCACATCAATCAACGCGTT
AACATTTCGAGTCCGTCGTTCATTTCCCACCTCATCCAGGTCTCGACTGTGAGGTTTCTGTATAGGTGGCAATAGATTGAACTTGGAGGTGGTTCCATAT
CACTGCCCTCTTCTGTTCCCTTGCCCGCCACGACAACTGCATCTCGAGGTTCAGGAATGATGCACATATTCCGGGGAAGGCATATTTCGTTATTACCAAG
CCCATCGTTCACAGGGTAGTGTCTTCACCTATCTGAAGAAAGAAGTCAGAAAAATCGGCCAAATCGGCCGCGCTGGCAGGATCGAGAGCCGTCCGGACGC
ACATGTTCTCGGTCAGACGCACTTGGCGCAAAAGCTCCCACAGGGGTGAGCTCTTGAAGCAGACTGCAATGGTTTCAGCCGGTGTAGCATCCTTCAGAAC
AGGCAAAATCTGGCGATGGTCTCTACTGACCCCCCCCCCCCCCCAAACGGCTCCAGGTCGTTCTTCATGATATCACGAAGCGTCATATCCACCGCTTTAA
AGCAACCGAGATTCATCGTTGGAGCTTCATCCCAATAATCAGACTGATATTACGGATCAGCTCC