Description :
From Genome Similarity Track
Location :
Scaffold_1787:1460- 3555
Sequence
2095 bases(100 bases per row)
AAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCA
GCTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCG
ACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACATGTGGATCACTTCATCGAGACGCTGGGAGAT
GTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAGCATGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGA
AGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGA
GTCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGCCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGA
CCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCCCAGGTCAGGTGTTCGCAGTGCGGATCCCGGAAGC
ACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGA
GATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATAGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCC
GAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGA
TCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAATTTGCC
AGATCCGAAATCTCTTCAACCCTGGATCTACAAAGAGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTG
AGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCTGTGGATCTGAAGAGAGTGGATCCATGGATCTGCTGACAGGGGAGTCCCGTGGGTA
CTGGAAGTACCATGCCCCAGGAAAATGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAG
GTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTA
CGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGGTCTCGCTGGTCAAGACGCCATCCTTGG
GGATGGATTTCATGGTACCAGCTGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACC
CGTTGTACGGGGCGAAGATGAGGATCGTAAGGGCGGATAAGACAACCGGGATCGAGCCCGGGGAAACCTGGGAACTGCCAGATCGGCTAAAGTGGGTGGA
ACATGAGAAATTGTGGGTCACTCGGGGCGAGAAATGGGTACCTATCGTAATCCAAGGACCAGGTCGATCGCATACCTCCAGGTCACGAAACGTCAGCGAC
AAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCCGTGGGATCCCGCCGCT
ACAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTG