Description :
From Genome Similarity Track
Location :
Scaffold_2063:1460- 3488
Transcript NameFunction/comments
Phyag_g11987hypothetical protein PHYSODRAFT_350634

Sequence
2028 bases(100 bases per row)
GCCAAATGTAAACTGGTGCGAGTCGTAGTCCATGTCAGGTGCAACGTCAaagtcttcttcgtcttcgccgtcGAAGTAGTCGCGAATGATTCGCACAGAT
TTTTCGTAGATGTCTGAGCATTGCACAAGAGGAGAAGATAATTAATCGCGATGTTACATGTAAGCCTCGGTATACCAGGCCCAACCCACCCTCTTCTTGG
TGAAACTGCAGGTTCTGGATCAGCTCGATACCGTCCGCCTCCTCAATGTATCGCGCCATGCGATTCTCGATGTCTGTCAACGACATATCAGCCTCCCCTG
CCCGTAGAATGTTTTCCAGAGCGTCTAACGACACGTTGATCACTCGCGGGTCCTGAACATCCAGGAGCTTTACTAACGGAGGGATGCATCCTATGAGAAA
CATCCATACACAGGTCAGTTTCCACAGAGCCACACCCACCATCACGATTCGAGTACCTTGCTGTACTAAATATTTGATCTGCTCGGTGGTGCCGCCTGAC
GTTGCATTCGATATCGCccacgctgcttcttttCGGACGTCAAACTCGACCGACATCaactggaacagcagcggaggAATCACGTTGGCGTCGATCACAT
CCTGAATTTGGCTTGGAGTGCCAGCCGTGATATTAGAAATGGCCCAGCACGCTTCCTTGCGaatgagcttcttctcgtgcttgAGCAATGGCACAAGGCG
CGGCAGTACTACCAGATCAAGCATCAActgtgtctgctgctcaTTGCCTGTCACAATGTTCCCGATCGTGCGCAGCGCCGGTGTCTGAATAGATGTTAGC
GTGTGACTCGCCAGATCCACTATTCGTCTACACACTCCAGCATCGATAACGGCCTGAACAGTCTCGGTTGTGCCGTCCGAGAGATATGAGAGCGTCCAAC
ACGCATCCGTGACAACCTCCTCATCTGGTGAGTGGATGAGATGcggaagcagcttcagcgctGGACTTACTAAGGCAAATTCTGGTCTGGGCTTGCCACG
GCAAAAGTTCGATAGTGTCCACGTTGCATTCCGGAGTATGGTAAGCTTTCCTGAAGACCTTCGTagcactgcaagcagcgGCATCATCGCTCCGGCATTT
AGCACCAAGTCGCGACATTGAGGCGAATCTCCCGAAATGTTTCCCAATGCCCACACAGCCTGTTCGCAGACATCGTCATTTGTAGAAAGTAGCAGTCCGC
ACAGCAGTTCAACTGCGCCGCAGCTGATCACCACTTCCGTGTGCTCCGTCGTACCCGACGCGATATTCGTAAGCGCCCACGCCGCCTCAAACTGCATATC
TGGTCggtcgtgctgcttcaaaAATTCCACCAACAGCGGCACCACTCTCAGGTTGATCACCTCCTGAATAGGCGGATTGTTCTCtgctcaccaccaccaa
aaccACGCACGCCATCGCACGATTAAAACTTGTGTATCCTTCTCTCCAAACGCTACGTCAGCACCTACCAAGCGATAAcagccgccgcagcttggACACT
GCGTTCGACTGCTCCATTGGGTCCAGTGACTGGATCATTGCAGCAATTTTGGGCAAGTCTGACACCTACAAACACAGAAGAATCAACACATTATTCACCC
GTCCACAGCTCTTCACCGGCAGTATCAGTCACCCTAGTCACGCAAAACAAAGCGTACACTGACGCCGTTAAGAGAGCGCATGGGCACGTCTGGACTGGTC
TGCATCGGCGTCTCTATACTCATCGATacacctcctccactgctAAAATCCTGCCATCACCACAATAAATTACGTTATAAAATAATGCGATACAGCATAg
caagagagagagagtggCTTTATACCATAGGAATCATGCGTCTCCTCTGGTTGAGGCGCTCCTCGCGTTGGCTCTTGCGGATTTGGATGGTGGTGTCTTC
GCGTCTCCGTCGGGTCTCGTCTGCGTCGATTcccttcttgaagctgcGCATTCGGTCCGCGATGCGCGCTGCGGAGGGGGAGACGCTTGTGGCCATCGTG
TTGTGCTGCAGTGGACCCGACTAGGTGG