Description :
From Genome Similarity Track
Location :
Scaffold_2166:1460- 2866
Transcript NameFunction/comments
Phypl_g14765hypothetical protein
Phypl_g14766hypothetical protein

Sequence
1406 bases(100 bases per row)
ATAGCCTTGACCTCAAANACATGCACCATCGGATAAAACCTATATCCACCCCGGTCGGGCAATTCCAACTCGTACGCAAActcctcgaccttcttcttca
cacGGAATGGCCCGTGCCATCGGTGGACCAGTTTCTTGGTCAATCCCGACTTCACGCGTTCCATGTACAACCAGACTCTGTCCTCTAGTTGGAAAAGAGA
CCTCGGTCTCGCGTCAGGAGCATCGTCAGCTGTCCCTGTCTCCAATGGAATCTCGTCCGACGCCTCGTTCTCATCACCAGTAGTCGGTACCACCGCTCGT
TCACGTCtcccaagcagctcgttATGTTCCTTCGCCTTATGAGCTTTCTCGGTGGCCTGGTATTCCATAGCCATTCTCCACGAAATCTCCTGCTGTCGGT
TCACCTCTCGGCGCCACGCCAGTACACCGGTCTGGCCCCCAGAGCCTCGTTGGAACGACGAAGACATTTCCCGGAGCGTGGACTGTGCATCCCAACCACG
AACGAGGTAAAACGGAGTGTCCTTCCTCATTTCATCTTGTGAGTTGTTGATAGCGAAAAACAGTNCTTGTGAGTTGTTGATAGCGAAAATCAGTCGCTCG
GCAATCTCGTCCCAGTCTTGCTGCAAGGGGTCTTCGGCATAGACGCGTACAGACTGCATGACTGTCGTCACCGACCGTCCCTGCTGACCGTTCGCTTGTG
GCCGATAGCTCAACGTTGCTCTCGACCGAGACTGCATCATCTCGGCAAAAGCTTGGAAAACCTCGCTCATGAACCGTGGGTCACGGTCGTGGCGAATCAA
CGTTGGCGCTCCGAACCGTCGGTATACACACTCTTCGAAAGCGTGCGCCACCTTTAGTGCAGTCGTGTCGGACATTGTTTTGCCCATCACGAAACCGGTG
AACGCGCACTGGAACAGCAGTAATGCCGTGTTCTCACTGCGAGACTTCGGTAACGGTATGACGAAATTAATAGAGACAATCTGGAACGGTCTCTCGGCCA
GGATGTTCCCTGGTGAGTGGCCTCGGAACTGCGGTCGGCTCTTGATCGAAACGCAGTCTGGGCAAGACTTCACATGTCGCTCCACGTCTGCATAGACACC
AACCTAATAGTAGTCAGCCCTGGTCCTGTGATAGGTCCGACCGATACCTTGGTGGCCGCCTTCCAGCGAGTCGTGACAGCTCGGTAGTACCTCCTGAATC
ATCGCTGTACGTCGAATTGTCGTCTCCCCTTGATGTTCAGTGCCCCACCGACGGTTCACTCCAAGAAAATAGAGTACATCGTCTTCGCTGATCACGAACT
TGTCCGACATCTTCCATGCATCTCACGCCGCCTGGTAGCCGAGTACCTCTTCCTCGCCTCGTAGCATCACCTTGAGATTGGACCACCtcagctcttcatc
ttgagc