Description :
From Genome Similarity Track
Location :
Scaffold_189:1460- 2853
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015026Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
1393 bases(100 bases per row)
CCTTTCGTGGAACTGGAGTCTGAGCAGGTATGGTCGCATCATTCAATTTGTTGAATGCATGAACAATGCGCCAACCGCCTGTGGCCTTTTTAACACAAAA
GGTGGGACTACAGTGCGGAGACTTGCTCTCGCGCACATGGCCAGCGTCTGTCGCTGCGCGAAAACTCATCGATCGCATCGACTGTTCTTCGGTAGCGACC
ATTGCCTTGTGATACAGTACTTTGTTCCTGGAAGTACATCTATCTCGTGACGAATGCCTCTATCTGCGGCAATTCGTCCGGCACTTTGTCTGGAAATATG
TCAGCATATTCCTTGACAAGTCCATACACGGGGTTTGTCTTTAGAGCGTCTCACGACTGCTCATCAAACCTTTCCTTCCGTGTCCTTTCATCTAACACTT
CCGCAGTGTTGATAGCATCGCCGGCAACTTCATCGACGATCACACAAATTTGCGAAATTTCGCCTTTCACCAGGCTACGCTTAAGCGTCTTCTTGCTCAT
CAACGGCAAGGAAATCAATTCTTGAGCCAGACTTGGAGGATTTTCCACTTGCACATGACGCGCTATCTGGCAGTCGCCTTCTTCATTGTAGACTACGACG
TTCACGTATTCACTTGAAGTGGCTTGTTCCTGCCTCTTCACTTCATCTTCTGCCTTCCTTGTGTCTTGATCAGGGACGCTTGCAGATCTTCGTTCTTCTT
CATCGGTCTTCTTATCTTCTTTAATCCTGTCAGAGCAGAACTCTTTATCGCTCTTGGCCACAGGAGTAGTCTTTTTCTGGCGCCTGACTACTCCACCTCC
AGTGGTCTTCACGGGCTTGTCATTTGAGTGTGAGGGGCCATCGCACGCCTGACTCTCATTAGACACATCTTCAACAGATGTATATGACCAAATCACCTCT
CTTGCTGTCAAGCAGCCGAGGTCTTCGTCGACTTGCTTGTCGACGCTGATCTTCTTCTTCTTCCAGTCAATGCTCGATTGGTACCTTCTCAACCAGGGCA
TTCCCAGAATCAGATCAAACTTGTCATCGAGGTCGAGTGCTATAAACTCGTCTTCACCTCGGAAATCATCACATTCGATTGCCATACGCAACACGCGCTT
AGGCATCGTCACTTTCGACCCATTCGCCAAGCGAACGATCATTTCCTTGTTCGAGATAGGCAGGTCCAAACCTTGCCTTCTCACCACTTGTGTGCGGACA
AAATTGTTCGACGCACCAGTGTCTACAAGAGCCCGTAGAGGTTCTGAGTAACCATCTACCTTAACCTTGTGGACTATCAAGGTTGGCTCTTGCTCGACAC
GCTCACATCTGTTCGCGGAAACTTCATGTGCGTTACACACACCGGGGCAAGAGTTCTGCGCTTCCACGACATTCACAGAACTCTTAGTTCGCC