Description :
From Genome Similarity Track
Location :
Scaffold_2019:146- 3114
Transcript NameFunction/comments
Phyag_g11908hypothetical protein

Sequence
2968 bases(100 bases per row)
TACCGCTATTGAGGTTCTAACTATTGCATTCAGGACGACCGAGACTGCCGTATTTGGGCTGAGAAGGTTTGGGCACAGTACGTTGCCATGCAAACTTCAt
cgctgttgtcgctggacgagttcaagagTCATATACAGCCAGGATTTGGTCGACAGATCAGTGATTTAGGGACCGATCTCGCAGTCATTCCAGGTGGCTA
TACctgcgtgctgcagccgtgTGATGTGGGTGTGAACAAGCCCGTAAAAGAAGCAGTGCGCGCTCAGTACGATGACTGGGCGGCTGAGCAAATGACATCG
ATTCCCCCGGAAGCCAATGTACCAGTGCCAAAACGAGAAGATATCGTGCCTTGGATTGTTAGAGCCTGGGGAGGTGTGGTGGAGTGCATGCCAGAAATCC
GCGGTCGTAGTCACGATCGTTGATCTCCGACAGGTTTCCAGAGCACGAGACGACGCCCCTTCCTTTAGTTGACGTCGCAATTCCCCGGAACTTGTACTAA
CGTAATTCCGAAGCGGTAGCGCGGTAGGCAGGAATATACCTTGTTTATCTTGGCCTTGAGGTCTTGGTTCGTAGCAGCGCGGGGATGGGCTTTTCACGCC
GCTGGTTgtctcgttcttcttgtcttggaTCGCGTAGGGCCCTATCGTTGCCGCAACACGTCCGTAGTCTTCTTCACACGTCCACTTGATCCCTATTACT
TGATCGGTGGCTAGTGTTCTCTCTCTGTCGATCGCTCTGCCCTTTACCTTGCTTTGCGTCGACGTGCCTCGGTTTATAGTGCCGTTCTGCTGACACTCTG
GGTTGGGTTGGGCACGCGGgaccttgctgcagcgccatgtATCGCCGTTATCCTTGGCGATCGGGGTCGATTCTTCTACAGGGGTGATCCTTGAGCGCTA
AGTAGCGAACTTAGCTTCTTTGGAAACGAAGACGTGTTACTTGGCTTATCTACTTCGATGCAAATTGCGAACTGAACTACTCTAACTCCTATACGCCACG
TGTCGACCCATCACACTCTGGCTCACGTCCACTCGTTGCTCCCCTGGCTGGTGATCGTGGTATTATCGATTGTGATCGCCGATCGTGGTGACCATGACAC
TGCTGATCGTGCCGATCTTGACACTCTCGATCGTTGGCTACAGAGATGATTGTGATCGTCATCCGCACTTAGTCGGAAAGGAGTGTAAACCTTCCCCCAA
TTTCGACTCTGCCTTCGAGGACTCACTCGCCCCACTAGCAGCTCTCTCACATCCGCTACACCACATGTGTCTGATTGAGATTAGCTTGCACAATCGGCAG
CAAATACTCCCAGTTACGTTCATCCAACCGTAGCTCTAACAGTAGCGCGCGGACGACCTGCAGAATGTCGCGATTAATACGCTCCACCGTCCCATTAATC
CAAAGAGAGTAGACAGGTACAAAACTCTGTACACCACGCAGCCTTGTTGCTAATTCTGCAAGAACAGCACTGCGGAAATGGCTACCTTGATCGGTAACCC
ACTTCTTGGGCAGCCCAAATCGCTTGTGCCAGTTGAGAATCGAAACTACAGCAACGTCACTAGTTGGAGCATCGCATGCCACCAATTCACAGTAATGCGT
TAGTTCGTCCTTCAGGACAAGTACATATTTTGTCAAGCCATAGCTTTCCCCCATCGTGATATAATCCATATGCAGGACTTCGTTCCTCGTCGCGGGTGGC
TGTGTCTCTGACCACGGTCGCTGGATCAATTTACCACCTTTAATATGTTTGCACAAAAGGCAGCGGTTCACGAAACGAATTGCAACTTTCCGCACATTGC
CAATGGCAAACCGTTCTTGCAACACGTTTGCCATAGCCTGAGCTCCTCGATGTGCCTGCACGCCACAACGTGCAACGATAAGCACACGATTCAATAATTC
CTTGGCCTGTAGTGGAATCCACAGCTTCCCTTCACTATACAGCAAATCGTCTCGGGCTTCCAGTGAAACCGTAACTGAGTTACGATAACGAGATTGTGCA
TCACGAACAGCTAGAAGCGAAGGCCATTCGAAGGTATCCTCTTGCAGTGGCCTCAACCTGCTTGATTCTGGTTGGCTTCGAGTGCGTACTGCCTTCGTTT
TCACTACCACATGGGTGTCCTCACGTACCGGCCATCTTGACACTATATCTGCTCAATGATTATCCTCCCTACGAACGTGGTGAATGGTGTATCGGCTACC
GATGAGCTTCATGGCCCAGCGCTGAAGCTTGCCACGTACATGTTTTTTCAGATCATGGTCGGGACAGAAAATCTGAATCGAATTCGCATGGTCCGAGTAG
ATGCGGTATCCTAATGGTCTATGAAGAAGATAGTCAAGTACAGCAGCCGCATATACCACAGGATACGCCTCTTTCTCGAGTACAGACCAGTGTAGCTGCG
AGTCTTTAAACGATTCTCTCTTGCataccagcagctcgtgatGCTGTTCGTGAACTGGAATCCCATCCTGCCACTCCCTCACCTGAGTGAGGATAAATTG
CCCAGCCTCGATCCGATGCATCGGTGCTCAGGCACACAATTGCCTCATCATCTGGAAATGATAATGTCGCCGAACTAGCTAGACGCCCCAGAAACTTTTT
GTACGTTGTAGCTTCTTCACTATTCCATTCCACAGAGACACTAGCAGCATGACGTTTGCGTCGGCTCTGGCCTTTAAGACTGCATCCAATTTGGCCTGCA
GAGGTTCCACTTCACGTCCATAGTCTACAACCGAGTCACGAATCCAATTGGCAGCACAaaggaagtgctgcaactcTGCAGCATTCAACGGTAATGGCAG
TGACACCAAAGCATTAACTCGTGCTGGATCATGGGTCACTCCATGTCTATCGATGATCCTCCCACACCAATGAACGGATTCCCTGTAGattctgctcttc
ctcaaaTTGAGTTTCAAATTGATCTTGCGAAGACGTGAGAAGAAAATCTTTAACACCTCCAGGTATTC