Description :
From Genome Similarity Track
Location :
Scaffold_23:146- 2012
Sequence
1866 bases(100 bases per row)
CTCGAAGCTCTGTAGCGAGGGTTCCTCAAGCAAGGCCAAGCGACTTTGTGTATTGGCCGATTACTATCGGGAGGCTTTACGTGACGGCTTATTGTTGCCT
ATTTGCACGACAGGGAGTGCATAAATTGCATTCCTTTTATTCTTCCAACCGAGTGTTGAGCACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTAC
CCTTCCGCTGTTGGGACCACGAGGATTCAAAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTACTGGTTGGCCTATATAAGTAGTTT
ACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTAGTAGACGTATTGTTGTGGGAACGT
CCTAACTACATTTGTAGCTAAAATTCACGTGGGAATTCCAACACCACAACAGGTGCCGCGACCCGGGAATAGATTGTGACCATTGTGAACTGTTTGTATA
CCCTTACAGTTTACGAGCTACCAAGAGAAGATGAACAAGAAAACGAAAACAAGAAGCATGGCGAAAGGACAACCGACGGTACCAGTCACGCCTGCCAAGT
CTGGCGGGGCTCGCAACGAGAGTTCAAGCCCGGCTGCGCGCTTTGCAGCCGCCACCGAGCTTTCAGTGAGCTTCGACGACGAAGCGGACAGCGGTCCTGA
AGCCCACGATTATGAAGATAACGAAGACAAGACGCCGGCTCCAGAGCCAGGTTCAGCGACGCCGGAGACGGCCACGCTATCATCGGGGCTGAGCGGGGCG
ACCAGGTCCTATTCGAGGAACCTCGCCGACGAGCTCGATGATGTTGCGGGACCGGAACCGGGCCTACGAAGATTATGACGATGGGACCGAGGGTTCTAAA
CCTTCGGTGGCGAGTGTTAAGCATTCAGCACTGCTGAAGGCACCTCGCCCACCTATCAACGGTGATACACCAGCCGCCAAACGCGTTTTCGAACGCGTAC
AAACGCTGATGCAGAATGATGAGTGGATGCAGCTGCTCAAACCCATCCCCAAGAAAAAGGCCGATTGGCATGCGCTTGCGCAGGAACTTCAATACCCAGT
CAACTCGGTTTCGACTAGCCAAGTTGCCGAGGGTTCAGTTTCGCTACTGTTGTCGCTGGGGTTCGAGAACGAGACGTACCCATCGACGATGTCGCTTCAG
GATTGGAGTCCACATGAAGCCGGAGCTGCTCTCCAGAAATGGAAGAAGAAGCTTCGGAAGGAGTTTGGCGCCGTTGGCATCAATGCCGGAAAGCAACCTG
TGAGGCGACCGATGATTCAAGATGAAGATCCGTCCAAGATTCCATTGCCGCCGACGCCCCAACGACTCGTTCGTACTCCTCCGACCAAGCGTGGAGCTGA
GCGTGGTGCCTTTGGCACTACCGAAGCTTCACCGTACTTTCAAGACTCGCACATGGTTACGCCACGTTCGGAGAGCCGTATGCAACGTATTTACGCAAGT
AACGAGGGTTCGTTCGGTCGCCGAGGCGGTGCGCGAGCTCCCAAAGGTGGTGCCGGACGTCGTCAAGTCGACAGCGATGGTTCGTCCAGTGACGATGACA
TTTTGGTGCGTACATTCGACGAGGAAGATCCTCAACTCGAGTTGATGCGTCAGATGAATGAGCTAGCGACGCTGAACGACGTGGACCCGACACCGAGGAT
TGAAATGGCTTCGCACCGACCGCTGGATCGCATCACGCCGTTCTCAGGCTCTCGCAACAAGAGCGAGAACTGTATGCAGTGGCTCCGTGGGTTCGTCTAT
GAAATGACTGGAACCCACACAGATGCCGATAAATGGTGCATTCCATTTGAGCTAAGTCTCCGGGAC