Description :
From Genome Similarity Track
Location :
Scaffold_2178:146- 1867
Transcript NameFunction/comments
Phyta_totarag14206hypothetical protein

Sequence
1721 bases(100 bases per row)
CCCAGTATTTGGCACAAGGACCAGAGGAATGTCCACCATTTGGGAACTCCATGTAGATTGTTCTTGACGTCTAGCAAGATTCCCTTTGAATGCGAACAAT
AACTGCATAAAAACATGATACCTGCAATTGTGTTGATATAAAACATAAGCGACTTATCTCCTTTTACGAAATCGTACCGTTACGCTATTTTGAGCAGAAT
AGCGTATGAACTATAACGAGGTTAGACAGAGCGTAgatggaagaggagaagaagaggcttGTTCTGAAGGCGTCAAAAGATGAAGTGAGTGATATtagag
aagaaggaagttAAGACGCTGTCCTACCGGCAGCGTTAAGATGACTGGTCTGCAAGACAGTCATGGATCGACCCTAGCGTCCACTCGAATATAGTGGACA
TCATACGTAACAGCTTAAAGGGTTTTTGTCACTGTCGATCATCAGCTCTTACCGATAGCATAATACAGTGTTTCACTATGAGAAGAGGCATACCGTGACA
GCCTCCCTGCATCTTTCCATAGATTTTGGCATGCACGGATGTATGTGGGATTGGAGGTTTGATGTATTTTTCTCAAGCGACGTTCATTGTCGAACGAATT
CTCTGCCGAGGAAGCCTTGAGCATAGCTGATTTGACGTTGTCTCGGCGGCATTGGTGCGGAGGGAAGAAGGACTTTGGGGCACGCCATGGCGAGAATTTG
GGCGATCGGCATCGCGCGACCAGTGACCACGGCGGCAAAGGCTCCTCCGGGGCCTCGGAAGAGGGCGGACAAGTAGAAGAACAGGATGGCGACCAAAATA
AcggccatgaagaaggccaGGGTAATTGTGCGAGCAGTCACAACGGTTGCGGGGACTATGAGGGAGAAGGCTGTTGGGGCCACGACGCGCAAGATCGCAG
TGGCCGCGGCGAGCGAGCCcgcagagctgcagcctctTTATGAGGCTCGCATGGAGACAGCACCCGCACGTATTGTCACTGAACTTGGGGAAAATAGTGA
CCAGGCCGTTTGTAACAGGACCACGGCTGTTAGCAAACAACGCACCACCGCTAGTAACGAGGCTGTGGCCGTTAGTGACCATGTTGCAGCCGTTGCTGAC
CATGCTGCAGAGGCCACGGGAAGCTAGGTTGTGACCGCACGCGCACCTGCTGTAACCACTGCAGTGCGCCACTGACAAAGTTGTTCTACCGTATATACGG
GACATATTATGGGCAACAACGGTTAACAGTCGGAACTGACTATGTGACAACCAAGAAAACTTGGCACGTCGCTCGGATTATTGATCGGCGCTCTACCAGT
CGTGGGATTGAGTACCGTTGTCTCTGGATCCATCGTATTCGATTACTATCAGCGGACTTGGGAGCCtaagcagcagcttctcgacgacgactttgGCCAA
GAGCTGGATCTCGTAGACATGTAGAAACTAGGAGAGTTTCGATTACTTCTGCAAGGACGGCTCATACGGACAGCACACCATTGCAGCGGACATGAGTGGA
TTGTGTTTGTTCAATGCATTCAAGTACGCATCCGAGCTGTCCGGGCGCCCCGACATAGAGACCGATAGTGACATCGAGAATTTTGTCGCcgatgagctgc
agcattaCGGACTCGACCTGACGTAAAGGACTTCGTGGAAAGTCTTCTTGGTTTTCCTGTGTCGCCTTCGTGATGGCAGCAGgaacttcatcttcaagGC
CATCGACAAGGACAATTATAC