Description :
From Genome Similarity Track
Location :
contig_17:145986- 147160
Transcript NameFunction/comments
g4014.t1hypothetical protein PHMEG_0009612
g4015.t1IQ domain-containing protein G

Sequence
1174 bases(100 bases per row)
GCTTTGACTGGGAACTTGGTCGGCAGCTCAAGCTCCTTCTTGGTGTGGTGGTGATCACGGCCGTCCGTGTGTCCATGTCCTCCATAGCTCGAACGAACTC
TTTACTCTCCAGCTGCCCGAACGGGAGGCCGTAGCGTCGGTTTCTCCTGGTGGCGTCGTCCGTGGGCGCGTCTCGTTTCCTGTCGAAGCAGCCCCGGGTC
TTAAACGCCAGCAGCAGACCGCAGATCAGGGACACGACGGCGTACAAGCCGCCCGCGATGTAGCAATTGACCTCCGCAGAGCTGGAACGCACGTGCAGCC
CGCGCACGAAGCCCGGCTGGAACCGCAGCAACAAACCGAAGACGGGAATGAGGACCATCCCAGCCAGCGACAGCGCCATCGCGGCGCGCAAGTAGCTGCT
CTCCATGTCGATGTCTCTTCTTGGCAAGAAGTTCGTACTTGAAACCCATGTAACCTCAGGAATGAGATAGGTACGTAATACCCCTTTGGGATTGGTAGAT
AAAAGTGATAACCAATCATATCATCGGATTGAGTAGCCATTTTCCGGTGGGCGCCTTTTGTTGTCTGCTGCCAATGCAAGTCAATTTTTGTCCTATGATG
CTATTCAGTTGGGTTACCTTTTCCCTGCACAGGCAGTCTACAAACCGCGCCATTCTACCTTTGTGCATCGCTCTTTCCTCTTCAAGTTCGGCTCTCTCTA
TGCGCGTGTGCTGGCCGGAGCCTTGTGATCACGGAAGCTCTTGAGCTCGGCAAGTCGCACGAAGCGGTGGTAGATCAGCGGGTGCAGCTGACTGAGCCGT
CCCGGGTTCTCGGCGAAGCACACGAACAACGTCTTGATGACGGCCGCGATCACTTGCGTGGCCAGCGAGATGGTCGTGTAGCAGAGCGTGAACGCCGCCA
ACGTGAAAAACGTCGCGTGCGACGATGCACCAGCAAGCGCCGACGCAGTCAACGCACTCATGATACCTGCCCAGCCATTGCCACCGAGAAGCAGGATGCG
GCTCGTCAAGTCGTCATCCACGATCGCCTCCACGCCGTGATGCTCGATCAGTTTCCACGCGTCCTGCGCCGCCACATAATAAGGCTTGTTGTAGCCAGCA
ACGTGCACGAACGAGTACTTGTGGTACGTGCGGATAAAATACTCCACTCGCTCTGAGCGCAGCGACATAAATCT