Description :
From Genome Similarity Track
Location :
Scaffold_74:14593- 46499
Transcript NameFunction/comments
Phymu_g3505cysteine protease family C01A, putative
Phymu_g3506Mitochondrial Carrier (MC) Family
Phymu_g3507conserved hypothetical protein
Phymu_g3508hypothetical protein PHYSODRAFT_309171
Phymu_g3509Mitochondrial/chloroplast ribosomal protein L13
Phymu_g3510hypothetical protein PHYSODRAFT_293850
Phymu_g3511hypothetical protein PHYSODRAFT_248380
Phymu_g3512Rab1 family GTPase (PiYpt1) putative
Phymu_g3513hypothetical protein PHYSODRAFT_537941

Sequence
31906 bases(100 bases per row)
CGTTGCTAAACATTGCTGCGCTGTATTGTTTGACTCAAGTATGAATGAAGCTACAAAATCCTGCCACCAGAGCTCACGCACGTTACGAGCCTAGTGCGCT
GCTGACTGCGGAGCATTCACTGGAGCACGGTTGGGGTACATGaccgagttcttcttcctgatCGTCTTGAGCCTTCGCTGCGAAATCAGCATGCCGACGG
CAGTCATCACGATCGTGAAAATAGTCGTCACCGCCGCAACAGCGATCCAAGCTGTGGGGCTCAGGCCCACGAAGAGCTTGTCGCCGCCGCTGTCAACACT
TGTGCTAGCTGCAACACCAGCTGAAGCGCCCGTAGGGATAACGGGGAAGATGTCCAGGCCACAGTTCACCTTGGAGTCTGCCACTAGCTTCATGAAGCCG
CTCGCGCCCCACGAACTGCCGTACGAGTTCTTGAGGATCCAGTAGTCCCCCTCCGTAGCATCAGTGCCGTAGCCGACGAGCACCAGAGCGTGATTGACGT
CGTTCTTCGAAGACAGCACGCCATCGTTCGGGCAACTATAGAAGCCGCCGGCGTAGTCGCCGAACGGGTCCTCCGAGTTGATAGCCACAGCAATTGGCTG
CTTTTCCAGCGCAGTGCGGAGCAACGTCGTGCAGTTGCTCGACGCTGTGCAGTCCGAGCCCACAACCTGCTCCCAGCCCGTGATACTGGCAGCCGTCTCA
TTGGCACTCACAGTGCACGCTGACGACTCGTTGTTCGAAGCCGTGCTTCCTGAACCGGAGTCATCGTACGGCATCGTGAGTTCCGTCACCAGTCCCCACG
AGTTCTGCGCCGCGTCAATGAAAGCGCCGTGAGTCATACCACCATTACAGCCATTATTCTGCGACTCCCACTTaatctccgtctccatccaCGTCGCACC
GGTCACGCCGCTGTCGGACGCCCAGCAGTAGTCAAAGGTCTGCGTCGTTTCCAGCGTACTGCACGACAGGAATTGCTGAGGCGACAGAGACACAGCCGCC
GACGCGTTCTcagcgatgacgacggcCGTCTCGATGGCATCAGCGGCAGCAAAGGCCCAGCAACTGCCGCAGTTCTGCTGACTCTTGACGGACGAGCACA
CACTGTAGCCGAACGAGTTGTCCGTGTCGCACCAATTCCAGTACTCGGAGCTGCCGGAGCTCGACACCGTGTTGGTAGTGGATGCCGCACTGCCGCTAGC
TTCAGATCTGAGACGACGCGAGCGAGCTGACTTGGCCTCCTGATCCACAAGTTGCTGAGGCGAGAGGCGACGCCTCGTGGAGGACGTCAAGTGGCGCTCA
TTTACACCCATGTTGTACGAGAACTCGTGGCCCACGCTCTGGGCATACATGTGCACGTCCTCGATGTACGTCATGTGCGTCTGCAGGTTGCGCGTGAGAC
GGTCGCGGTCACCGAAGGACACGAGGCTGCGCTGAACGAGCAGATCTCGCAGACTCTTCGAGTCGACGACCTCGCCGTTCTCGCCCGCCCAGAGGCATCG
GGACTCAGCCGAGCGCACAGCAGGACACTTGACGAAGGAGCCAAGAGAGAGGTCCGTGGTGCGCGCAGCGGAAGAGGGGGCGGCGGTCGCGGagaggacg
atgaggaaCGCTGGCACACGCATGAttagagctgctggaggattGTTGTGAACTGCTGTCTCTTTATGTAGTTGGACACTAGAAAAAAGCACTTTTTAGC
GTCTTTTGAGAACAGGCAAAAATATCATGCACTTTAATTCAATAGCTGTCATTGTTCACGTCCTATCGCCCCTGGCAACAGTTCgtggagaacaagaagc
acacTTATagactaccggtacacaTCAATTGCGAGATGGATCACATGTGAACCATGTTACAAGAGCCTTtacatgtaatacatgtagctagGCCGCATAA
TTAACCCTTTTGGACGAATTAAACCATTTATCGAAAAATCACTAGATCAAGGAACCTATCCAGGTTTTCCAGGATACAGGTGGCAAGGTACGAAAAGAAG
CAGTGCTTGCAGAAATTCGCTTGACTACTCAAGAAAGATATGCTTGCCAAGCAGAATTTCTATTCCGTTGCTGCAACTATCGGTAGGATATCCAGCAATA
TTCCTGTTACGAgtcgccgccacctccgtgCTTTTTGCATCAGGCGACGGCTGCCGCTCTTTTCGCTGGATGTCTTTGCTTGTTGGTGATCGTTTGGGCC
AGCTGTCACAACCGCTGTGCTCTGTAACAGAGCCTCTGCTGCCATCTTGGCAGTCGAGCAAAGGAATGGCACCTTCATCAGCGAATGGCTACGCTGCGGT
cggtacagtacatgcaccAGCTCGCATCATCGGTTTCCTCTGGGAATGCAGCGTCCAGGACGAGCACGCATTATTGAGACGCTttcgtgtacatgtaagc
TTTAGTTTGTGATCCCCAGCGAAATGTCCGCCCGCGTGAATCTCGCATCGCAGCTTGATACAAAGTGCAAATTTCGCAAGCAGATGCGGCTGCATGGGCT
GGGCAACAGAGCCAAGCCCATTTCGCTGCTGGCCGTTTAACCGTCGCCAACACCTCGTGTTGGTGGTTGCCTGCGCAAAGACGGTcaagaaccagcagat
cctgATGTGTCCCTCTTCTCCGGGCTTCTGAGCAGCCGTGACCACCTCCCTTTTGACTCAAATTTGAGGTTTACGTCAGTCCATTCTCGGATTCGCAGCC
TCCTCCATCGCACGCGTCCCCGCAGCCCTTAATAGCATCACTTTGCCCGACACAATCCCCATtattgaagacgatggctACTCAAGCAGgtgtgaaggag
gaggccccGCTCCAGGTGAAGACGGCGATCGAGCCGCAGTGgacgcgcttcttcgctggtgGCGCGGCGTCAGCCACCGCCGAGTTGCTGACGCTACCCA
TTGACATCACCAAGGTGCGGCTGCAGGCTCAGCGTTCGGGCCCCACGACGGGTGGCAAGCCGGCGGTACACTACAACGGTATGCTTCACGCTGCGCAGAC
AATGATCAAGCATGAGGGCCCCGGTGCTCTCTGGAACGGAGCCACGCCCGCACTGCTGCGTCAAGTGTCGTACACGAGCATCTGCATGGTGCTCTATGAG
CCGTTACGCAACTTCTTCGGGGCGAATGCAGCTCAGGGCGCCAACGGTGAAGTACCCTTCATCAATAAGTTCCTGGCTGGCGGTTGCGCTGGCGCCATTG
GCATCAGTATTGCTAACCCGTACGTTGACAGCTCTCTTCATATTGAGCAAGATTGATTGACTAATACTTGTGTTGATCTTGCAGCGTGGATGTCATCAAG
GTGCGGATGCAGGCGGACCGCTCGGGTAAACTTTACCGTGGTATTGGAGACGCCTTCAGCATGATCTACCAGCGGGAGGGATTCCGCGGGTTTCTGCGTG
GTATGCCGCCTAATATTCAGCGCGGCTTCATCGTGAACGCTGCTGAACTGGGCACGTACGACCACAGCAAAGAGCTGTTGATCTCGTCTGGACTACTCAA
GGAAGGTGTGCTCGCTCATACCGGAGCCAGCTGCGTGGCTGGTTTCGCCGGCGCGGCCGCTTCGAACCCGTACGTAGTTTGGCTTTGTTGTATCGGTATG
GCGAAGGTGTTAGGATTGACTGACGTCGCGATGTAATAACAGAATCGACGTGGTGAAGACGCGTCTTATGAGCCAGCCGACAGACGCGAGCGGCAAGGGG
CTCCACTACAAGGGCATGATGGATTGCGTGCGGAAAACCTTCCATGAGGGCGGCGCAAGTGCCTTCTACAAGGGCTTTATCCCGAACTGGATGCGCAAGG
CACCCTGGTGCGTTGTCTTTTTCGTTACTTACGAGAAATACCGCACCGCTCTGGCgcccagcgacgacgagctgtaGACTATGTAGACTGTCAGCAAGCG
CTGCTGGGTCGAAATACACTGCAAGTGACTTCAACGAGAGCACACACATTGATCGATAATATCTTCGTAAAATTGTTTGCTTACTCGCGGTAGATGCTTA
CTACAATTACTCCTAGCCACTTGCCCCTGCTGATAAATAAGAATACATTATCCTTTTTAAGGGCACAACAGGGCAACGGATACGCATTTAGaaagcttct
ccttcgcttccttctgcctcctgcagcacgtgtTTCGCTCTTTGCTTCCGCCATTACTTTCGTTGAGTGACGCTCGTTTTCCATCATTTGCTGTTTGACG
TTTCTAGCACTTGAGTTCCTCGAAGTTGTGCATCTGCATGTACCAGGTGGAGCGTGGCGGCGTCAGGTAGTGCAAGGTTGAAGCTCCCTCTGGGATgctc
tccaccagcttctcgcgcAAGTCAATAAACTCATCCGTCTGCACGACATCGATCTTCTCATTGTCTGTAGGGATGGAGATGTTGCCGCTTTTAGGAAGCA
TAACAATCGGGAGGCGCTCTATGACGCGGTCTTCAGTCGACCACCGATCGCGCGAGATCACGTGCACGTTGAGGTTGGAGAAAGATCCGTTCATGAACCT
GTTCGAGATGGTGCTCTCCACGGAGGGCACTGcgacctcctcctcctcttcttcttcggagcAGTAGTAGGCCGGACACGTGCGGCGGCGACGCGTATGG
TGAGTGTTGGAATTCTTGGCGAAGAGCGAGCGACGGAAGCGGTCGCGCTCCTGTCGTCGATTCTCAAGCATCTCTTCTCGCGATAAGCGCTGTTGGTTCG
AGCTGTCAGTGGTGGGGACCACTTGTGCGCTGTTGTTGTTACCTCCCAGGAAgctgccattgctgctgctgatgcttcCGCGGTTAGTGCGGTTGAGAgc
cttgagcagcttctgaagGGCTAGGAACGTctcgtccacctcctcgtcctcagcgGAGAGGCTGGGATCGTCTTCCTCAGACACGCTGCCAGAGTAGGAA
GGCATCATCTTGGAATAGCGGGCGCTCGATCTCTCGACGGCCGCCATCTTTGTATCACTTGAAGCTTTTTATGAGTCTCTCACTGCACACAAGACCTCCG
GGTCATGTAGCAAACTACGATATGGGCGAAatgaggggggggggggggggggggctgCACTTGTCGCTCTGCGACGACCCAATAGATGACGGGATTCCGC
GGAATGGTGGACAGCGCGAGGCGAAATCGATTCTGGGACGCAATTGCTGGCGTCTGCGATCGACTTGGCGCATCAAAGACACGGTGAAATATCGCTTTTC
ACAGGTTGTCGGCGCTGATAGGCGAAAAGTGCCCTTCGATAATTTCGTTTAGACCGGCAATCAATCACTTCAACACTGCTATATTGAGCGTTGGGATTTT
GCTGGCACCATGCCatgctgtcgctgctgctgcttcactaTTCATGGCTTCGACGCTGGTGGCAGGCTGCcactggcagcgctggatgtcTCGCTCGCAC
GCCAACGGCGCAGCCGACATTAGCAGCATCAACGCAACGCCATTcgagaagaaagtgaaggtGATCGGTCGATGGTGATTAGGGTTGAACGCAGTTTCTA
GCTTTGCAAGTTTATTCTGATTAAGTTTTAAAGGTTTTAACTGTGCGGCAGGAGGATTTGCGTCACGTTGGTAACccgatctgctgctgccctAGGCTGG
AGTCCAGCTCGGAGTTCGGGCAGGCGTTTGGTCGTCGGAGCGCTCGGTCACCTTGCTCCGTTCATATACGCACAGCGCACCACTGTCACAGGATGATATA
CTACATGTGTACTTGCAAGTTGAAATCTGGCGTTGGGTAAAGAGATACCCAACGGTTCAGAGGATCACCATCAACGGCTCGCAATTCCAAACTTTCGCAG
TGGCCAGTGATGCGATTTCTCTCATCACTGTCACAAGGACGACGGCAATTGCCGCTGACTGAGGCTCTACCGACAAACAAACGCAGTGTCCAACACAGCG
CAATCGAGCttgcgacgctggagctccggTGATCTCGCCACCGTTGGAAGTTTACAAAGGTGACCGCACGTCTCGGCTTTTTTCTGTTCGACGCATCCGA
ACATCTGCTTCAACTAACAAACCTAACCATTTtacagtacactgtacttTGTGTTTCACACACAACTTGTGTAAACCACACAatgccacttcaacatgcg
CGTCTGTTGGAATTGCCAGCGACGGATCGAGCTCACGCCCTTGCCTGTCGCGTCTACTGCAATCCATTGCAGACTGCGTCTACCGTGAtggcggaactgc
tgctgtgctggatcAACcatgagctggagctgtcgacgcACGTGACGAACATGGAGATGGACTTCGCCAGCGGTTACCTATTGGGCGAGATCTTGCACCG
CCTCAACCACCAGCACAACTTCACCGATTTCAtgcgcagctccagcgccgacgCTAAGATCCTCAACTTCTGCCTGCTAGAGCCAACGCTACGCAACCTC
AACGTCAAATTCGACGCAAACGTGGCCGCCGCCATcatgaacgagaagaaggacgctGCCGCCAATCTTTTGTACCAGATAAAGGTGTGGAGTTCAACAC
CTACAAGGCAATGGAATTCTAACTGTTAATCTGATTTTGTACTGTTAGattgctgcttctcgagtAGGTAGAGCACCTGCCGTTTCGACCAAGTCGCTCG
AGCGGACGGGGATCATCCCCTTGCACAACAGACCAGTCAAGCTGGCGAAACCAGCCTATGATACGGAGAAGCTCCGGTTATTCGAGCACTCTGTTCGACG
GCATGCACGCTCAGTTGTCTCGCTACAGCAAGAAAAGTGAGTTCTGAGATGTTCAATTAGAGCAGTTGTGAGAATTGTGACGAGCTGTCGTTTCCAGGGA
TCAAATTGCGAATGATGCTAAGAAGAAAGCGGCGTACCTGGAGAAAATGGCAGAGCAGAGAGAGGTATTGGAGGCGACAAAGGCAGAGAGATTGCATCGC
GCTTACATCCatagcagcttcatcaaGGAAGCCCTAGAAGAAACAGATTCGCCTGCATGGAgactggcgctgcagaagaaaagTGCTCGTGAACAGCGGC
GGGCTGCATTTTTTCAGCAACTTatgaagaagcgcgaagaagaagaggtgggCACAACGTATAGTGTCCTAACATTAAAGTTGTTGACGGCAAATTTCGA
TATCATTACAGGAAAATCTCACGTTTAGCCTGCGCCAAAAAGTGCGAAGTGATCTCGACGACTTTGATGTGTGTTGCCCTGAAAGCTTTCGGATTATTAT
CCATTGTGAGCTGACTATTGGTGGGTTTCTGACAGGCACAAGGAGgatcgaagagctcgcttGTAGGTGGAAAGGTTACTTCGCGCAAATCGGCTGGATA
CGGTCTGCGCTCGCTCACGACAGCGCTCAACGAATCTTcagacaagaagaaatatTCGACTTCAAACCTGGCAGGGTCCTCGATGAATGAAAGGGAGCTT
TATCACGCGAACGTTCTGGAAATGGAAAGCGCGTCGAGTGTTATCaaacagcaacgacagcagcgtgaaAAACGCAAGGACAATTTGTCGCGTAGGAGGA
AGCGGTTCGTTCAAGAATGCGTTTACGCCCACACGCGAGTCGGAACTGCTCGTGTTGCCAGCTTCCTTGAAAGCGTAGTGCTGCGGGACACGAACGGCGA
GAAGGATGTACATGACGAAAAGGACCGAATACTTATCTACAAGGAAGTAGCTCGGGAAAACAGGTCGATGCGAAATCAAGAGTATATGAACCAAAAAGAA
TCGGATTCTGTAGCGGCGATTGATCGAGATACGGGCTGCTATCACAATCTGCTCCTTCGGTTCGAAGATGACAGTGAAATGCAGGCTATACAACAGAAAA
ATGTTCAGGTATCTGTTGAAGCAGCTGATCGCTTTCTCAGTGAGGAGATTTCCAGCACTATCATGCACGAGATGGTGGATTTCATGCTTTTTGTTGCTGG
AAAACGGGAGGAGACGCGACATTCCAGAGATCCCTCCGTGTTTCTGTCTGCGGAGACATGGAACGAGTACAAGATTAAATTTGCGAATGACTGCAATATC
GGCAAAATATTTCCTGTTTCTGCTGCGAACCATTCAGATGAAGCTGAGTTACTGGATAAGCACGAATTGGAGGTATACTTGTCAAGCTTCCTGCCATTCC
AAACGACAAGTGAACAGCAGACTCCTTTGACAACGATCAGCGATGGATCTCTTTTCATTGGGGCAGAAGAAGTCATTAAGGACTGTTTCATCCTCGGAGA
AGAAATCAAGTCGTTGCGGTGGATCACTTACTTATCAAGTTCTGAGACCGGTACCACGTTGGAAAAGGATGAACCCCAAGACACTACAGTACCAGTATCG
TTTCAAGCTCCGTTGGGACCTCACCAGCATCTCCGAATTCTTGTCTTTGGACCTCCGTTCGCTGGAAAAGAAACTCAAGCGAAACTTCTAGGGGAAACGT
ATAACTTGTCTGTGCTCTCGGTTCACGAGCTGGTCCAAAGTGCAGTTCAAAACTCAAGTGCCATTGGCCGCGTATTAAAAAGTCTCCTGATCAATGGGAA
GGAAATTCCTCCAGAGCTGTACAGCCGGCTTCTGATCGAATCTATCGGGGAGATTGAATCACAAACCCTTGCGCAAAATACCGATAGCAAAGCTGGCTGG
GTGATCTATGATCTTCCTGGAACAGAGCGCCATGGCCAGAGTTTAGAGGAACGTCTTACTGGGTTCATGGATCCGGCCCTTATTCCTTCTCCCAGTGACT
TTGAATCGCCCATTGCCCCCGGTCGAAGTAAACCGCCACTATCACCGTCATTTTTCCACGGCAAATCGGGTGTGGATCTCGTTTTTCACATTGATTGCCT
TACTAACACGGTGTTAGATCGATGCTTGGGTCAAGTTGAGGATACCACGACGGGAGCCAAGAATCACTTGGTTTTTGACCCACCTCCGGACGATTCAATT
GTACGACATTGCTTACAGCATGTCAATCCGACAGCGTATGCAAGCGAGCTTTTGTCGCTGCACTGCTGGGCTAACGATGGTTTTTCTCGTGGTCACAAAT
CTTGGCATGCCAAATTCAAAACGTTGCACGAGCTTTCCAACACTGGCATGACTGTGAGTGAAATCCAAGACGCGATTGCGAACACTATAACCAATTTGTT
GAATGAGAAAAAAGAGGAAGCAGATGCGAAGCAGTTCAAGCTAGAAGCAGGTGAGCAGGCGCTTATGGCGAGTGAGGAGGGAAGGCAAAGACGTCTGGAC
GCTTTCGTCTCGGAAATTGACGAGGCTGAGGTGGATGTGGCCAAAACGCAGGCATCTGTGACggaagcagaggaagcaAAGGCAAAGAAAGAAGAGATTC
TGGAGATTCGGCAAAAGCTGGAAGCGGCCCAACGTCACCTTGAGGGTGTTCTGACCGCTGTAAAGAGTTGGATGGAAGAAGAGAGGTCCTGTCGTCCTGT
GCCCAGTAGTAAATATTCTGGCGAGTTGgtgccagcaacagctcggGCTCTGACAGCATTGTGGAACGACATGGAAGTGGAGTATATTGCTGTTATGAAG
ACAAGTTTTGCTTTGCTGCGGGAAGAGCGGCATCGAGTTACCGATCGCGCGCAGATAATGGCACGCGAGTTTTGCGAGTTTGTACGGCGTCCCGATCAGA
AACAAGAACTTGTCAATGTTTTCCAGAGGCAGTTCAATGAGGTGGTCGATGAGATGCGCTTTAGCGACCTCACCAAGTTCGAGCTCCATGCTCGAACAGA
TATTTTGCAAGACGAACTGGGATCTCTCGTCGAGTCGAAATTCACACAGAACGATGAGGAGCTTTGTAGCTTGGTTGGCGATGGATGGACTGAAGACACG
TGCCGGCACGTCGCTGCAATGTATCAAATGGCACTCCAGGCAGAATGCGACCGCTTCCGAACGTCTATGCAGATTCTTGTAGATGGGCACTACGCTGCAA
GTAGTGATCGCTCGCAGCTCACTAGTATTGTGGAGATTTGGCACTCTCATCAGCCTCGCCTGGAGGTGGCGTGCAGAGTTTATCGCGATCCGACAAATGA
AGTCCCAGTAGAAACTCCATCAGCACCCGCTGCAACAGGGAAAGCTGCTCCGAAGGGAAAAGCGAaggctcctgctcctgccgTAGCGCCTCCAACCAAC
ACTGCGGCGACTACCGAAGACGCCTTGGCAGAGTCTCTGACATTGACTGAGCTATTGGCAGAGTATGCACATGTTCTTCAGCGGTGTAGTTCGTGGATGG
AAGCAATTAATTCAATTGCCGGCGCACacgagcaagttgaagcggagaCCTGCAAAGTGAATTTACTAAATGGGATCAAGTATGAATACGGTTTGATGGA
GCGGCGAGTGAGctttcttcaagaagctACCGAAAAAAGTTGCGATGAAATCGCGCGGTCCATGCGCTCCATCGAGATCACACTACGAGACGTGTTGGAA
GATCGAAAAGACCGAGAACAAGCgactgtggctgctgttgttgaatATGTTCGTGCTGCCATCGAGGCGGAAGTCGCCCTTCCGATCTTCATTGATGTCA
CCGTACGTGTTTCTTACGTTAGTTTGATTTTGCCTTACCAGAGCTAATTGCTTGATGCTTGTAGCCTGAATTCGTCGAGAGGTTTCCGACTACAGCGCAG
TTGCGTGAAGATACAATGGTGCGAGTCGATGGGGATAGACGTTTGTTGCCTCGATCTCCCCCTGACGCACCGCCAATTGTTGAGGAAACACACGAATTAC
TTCTAAATGCTCGTCAACGGGATGATCTTCGGGAGGCTTTGACCACTCAGACCATCGACAACTCGGGACTTCTCCCACTCATCACTTTAGTGGAGACGAT
AACAGCTTTGGCATCGCTCCCCGATGCGCTTCCAGACGTCTGGCGTCGATGCCCCGCACACGCCATCGCTGAGGTACACCAGTACTTGTAACCCCCATGT
CATGAATGTCTCTAATCTGTGATTGTTTGTGGTAGATTGCTGTATGTTTCACCATGAAACAGTCGGCGTTCGTCGACATCGAGGCTCTGCTCACCGCCAT
GAGCACACGCGAAGACTTGCTCCGACAGttccaagaagacgaagctcgAGAGGAACTCGAACGTCAACAACAACTTGAACTCAAGCGCCAACAAGAGCAC
GAATGCGAACTCCTcctacaacagcaacagaccGAAGACAATGAAGCTGCCCCTGTGGATCTAGCTCAATAATCACACAAGTAATAAGGGGTGCACCAGC
CGTGTATTCCTTCTTCCACCAACCTCTCCgtgcttcctcttctgtcTATATCGTGTCTGGCCTACAGGATAACGGGGTCCGGGCCCACCTCTTCAACGAA
GTCGTGCTCCTCGCCCATGAagatcttgagcttcttgtcctgcaGCGCACGCATGCGGTTGCGAGGCAGCATACCGTACACAGCCTTGCGCAGCACGTCC
TCGGGCTTGCGCTCGAACATCTCCTTGGCTGTGCGCTGCTTGAGGCCGCCTGGGTGGCCCGTGTGCCAACGATATAACTTATTGTTCCACTTGTTGCCCG
TGAGCACGATGTCCTTAGCGTTGATCACCACCACGTAGTCGCCGCAGTCCACATTGGGAGCGTACGTGGGTTTGTGCTTGCCGCGCAGAATCGGCGCCAG
CTGAGAAGCCAGGCGACCAAGCACCTGGCCCTTGGCGTCCACCACGTGCCAAGCCACTTTAGAGGCCTGTGCAATCTTGCTCATGATTCCCTAGCGACGC
ACTCGATCCACTTCGTACTTGCTCCTGGCCGCAGAATGCGATTGTCGCCACCCGTCTAAAGCGGTACGAGAACGGTACTTCCGCAAATACCGGTCAAATA
ATAAAAAGCAAAATAAACAAAACAATAAatattatacatgtataaatATTTACAACAATATTTTACAATATAGCTTTCATAAAACAATATTTGTGCTTTT
TAAAAAAACTGAAATGACCAATAATTTGCAATAATTGACAAGGTACAGTCGCATTAATATTCAACAACTATTATAACCTTTCTAATGagattgtgctgct
gtacatTTCGTACCAAAAGCGATTTAAAAATGCTAAAACCTTGTTAAACACATATTTGCGACTATACTGATTATCGAGATGCACCACAGTGCTATGCGTG
TCGGGACGGATACCTATTCGCTTATAGGGTCCGTGCCCAATAATGGGCCGCTATACGACGACGCAGACCTTCAGCGACCAGGATGCGCAGGGCGCCGCCG
TGGCGTACAATGCAGCGGCATCAGAGAGCTCAGCAACTTCTATACCTGTCAGTGGTGTCAAGGATGACAAGCTCCACGTGAACCGCGTGGACAACGTGTC
CGGCAGCTCAGCGGGCGCAGGCAGCGGCGACTTCCACACTTACCGCGCCTCCAGAAGACGGTGCGATCGGTGGTCGTAGTAGCTAGTTGGGAGTTGCAAG
TGCATGATGATTTATTGTTGTGTTATTTATCAGAGAGATGGAGCGCGTAGCCGCCATGGAGCAGCGCTACAAGGAGAACAAGGCGCAGCGCGAGTTCGAA
GACAAACGCAAGCGCAGTGCTGATgagttcgacgccaagatgcagaagcgaGCCGAGAAGAGGCGACGACGCAAGGAACGATCCAAAGCCAAGGCCCTGG
ATGCAGtgcaggaagaggagaaggaggaggagcctACAggagacaagaaggagcaggtACCCGACACGCCGGGAGGTGTCCCGGAGATTCcgaacgacgg
cagcttcctagagaagatgctggcgctgcagaaggagaagaaggagaaatgAAAGGTTGGATAGACTTTTGGTTATGTTGTGAAAGGATTATTCTTTCTG
GTTACATGCAGCTCTTTCTCTTTTGCTGCTAACGCCGTATCATCAGGTACTAGTTGTCGTCTTGGAAGATCAGCGCAACGCCACGTAACACCCACTTAGC
ACTGCCGCAGTCGGTCGGCAGTGTCGCCAAGAAAATGTACGTGTGACCACGGAAGCGGGTGAGGTACACAGGGCATTCGTAGGTGTTGGGGTCGTGGCGC
AGGTAGCCCACAGAGGACGGTTCCCATGTTGGTAACGTGGTCACGGCCTTGACGTAGATGACAGGCATGCTCCAAAGCAGCTCCTTCGGGTTACTATCCA
GCAACGTACCACCACATTCTGTAGGCGGCGTCGCACCAACCGGATAGCGCTCGTTGATCTCATCCAGTGTGCTCCATCGTGCACCTTCGAGGATAAGTCC
GTGCACAAATACACCATCATCAGGGTAGTACGAGACCGTCGAAGAGTCCTGGATCGTCGTCACATGGGTCTCCACTGTCATCTGATTAAGCGGCATGAAG
CGCTTACGTGACGTTACCTGCAGACATGCCGTCGTGTAGGCCGTCGGATTGAAGAGACCCGGCAGCCACATAGAGAACGGggtgacgaagcagctcccgC
CTCCTCCTGTCGTGTCTCCAGCCCACATCATAAGTTGTTCATGGCGCTTCACCATGTCCGAGAACCAGCCACTCAGCGACTTGGTTGACGGCCAGGCTTT
CTTCTCCCACTTGCACTGCGAGAATGGGTTCCGTCCAGGCACTTCGTTCAGTGACATGGCTGTCGCCAAGTCTTCCATGGCTTGTGACATATTGAGTTGT
CCGTTAAGACCCTTCTTCAGATCGCCAAGCGACAACCGGATCTCCTGTAGTAAAACGTTCATTCGACTGCATTCCTGCAatgccaccaccacgaaaGGCC
CGTGTTCTTCTGTCAAGTGCGGCGTTGcggcctccaccacgtccaaCATGTTGAAGAACTCAGGGCAACGCGCCTCCAAGTCGTCGATGGACGCACGTAG
AGCTGCCGTCTTGTCcccacctcctccttcctcacctccgccgcctccagcacctcctccaaTCGTCACGATCGTGTAGCACAACGTCTCGCACGTAGTG
GTGAGGTAGCCGATTTCAGCATTCGGATGGAGCCCGAAGAGCGGTGGAGCCTCGGGAACcatgttcttctcgatgtAATTGGCGTAATCTGCGAACGAGA
ACTCTTGCGGATTCGGGGACTTGAACCCTGGACCAAGCTCCATTCCACTGAGCAGCCCTGGGTCGATGAGAACTGCCAGGTACGTGTTGTTTGTACGACG
ATCCCAAGCGTCCGTGATATGTCCGCCGTACATGATTTCACCAAATAGATAGCGCAGATCATCCCATGGAACAGAAGCGTTGTTGTCCAGGTACGAGTGC
AGAATATTGGCACAAATAGTGAGATCTCCAGTATTGAAACTGTAGGCACGACTCCAACCTTGTTGTCCAAATCTTCGACGGCCCAGTACGATGGCGTGGA
ACCAACAGAGCGAGAACAGACAGGCCTTGAACTCCGCTGGCTTCGTGCATGCCTGTACCTTATCTTCACCAAAGTTCGCCCACGCACGACGTAGGTTTGA
CTGAATATCCGACGGAGCCTCATTAGCGACCTTGATACAGCTCTGAAGTAGTGACTCGGGGATGTTTAACATGTCGGGCAATGGAGGTGGTTCCGCTGAG
ATGAAGCATCGGAACAGATCGTGAGCACCTTCAGTTGCCACCTCTTCCAGCTGACGCTCCAGTGTCGGCAGCCACGACTGCATTAAGTGCACATTCTGCA
AGATGATCCAACCGCCCTCGGTACTCAGTCGTTTCAATGCATCACCTGCGTACGCTTCCTGCCCTTGTCCCATGGAAATATTGATGAAATTGTTGTTCTC
AAGACTGACGCCGTTCGCTTTACCGAGGGTCTCGACCCACGGCGTAGGGTCCACGCCAGGGAATAACACGAAGAAAATCGGAATGCTCGAGTTCGTTTCT
GCGTACGTCGCCTCCATGTTGAACGGTGGTTGGGTCACGTACTCTTCGCCTAAGGACTCGAGGATGAACGTACGCAAAGCGTTGGTCACTCGATCCGGTC
GCATGGCACGAAGTAAGATCAGGCGCTGGAAAGCAGTCAACTTGATAAAGTCCCCTGGGATCTTCTGCCTCTCGGCATCTTCAGTAGCAAACCACTTTCT
CCACTCATCCGGATCGTTTTGAATGCCATCTCCCAGTCCTTGAAAGGCCTTTGCGCTTTCCAGtgccttcaacttggccCAGATTGCCGCTGGAAGCCAC
TCCGAAGCTGAGCCAGCATTGCCAGCGTCTGGGTGAGCCTTGCTGATGAGGAAGTACTCGACCTCTGAATCACTAAGTAAACCATCTTTCAGCAGGATCT
TGAGACACAGCATCGTTGCGACCGTGAGCTTGTTGCGCTCGAAAAGCCCACGGCGAACGTAGTTGTAAACGCACGAGGTGATGCTGTCCATCAGCACTTG
GCAGCGttccttcatctcctcgtcggtCAAATCCACTACAGCAGGCTCCGTGTCCTCTGCTTCATCGTTaccgccaccttcgccactttctgctgctgct
ggggccTCAGCGGCTGGCGCAGCTTCGCCGTCAACGGCACCCTCAGCTTCATTGGTAACGAGATTTTTTGCAGGTGGAGCGCGATAGATACCGGACAAAA
AGACCTGCTGGAAGGACGCGAGCGAGTAGATGTAGTAGCAGTGCACCTTGCTGATGTCGTTCATCAGGAAAAAGAGCAGAGAGCCTCGCGCGGCGATACT
GCGGTATTTCTCACTCGTGATGTTCACAGACTCCTGGGTCTTCTTCGCAGCTTCCATGTTGTTCTGTGTGCGTTGAGCTTTGTGCTTCGTGTCACTTAGA
ATCTGAATTAGAGGCTGGTTGTTCGTGATATCGTCGTCAGCGCTTGCTAGGTAGAACAGGATatcgtcctccagcttcttcagctcgatCTTGCCGTTGT
TTTGCTCCTGGATCAATTTCTCTCGTTTAATAGCAAGATCCTGGCGTTCTTTGGATACGACAAGGTTCAGCAACTGGTCCTCTAGTCCAAGCATCGTGAC
TGTAAAGTTCACGATGGTGCATTCAGCCTGGATCTCAGGCGGGTAGTGCGGGTTGCCCAGCTTCGTGTGCAGATACAAGTGAAAATTGTCGTTATAAGGC
ACCGACGCATCTCCAATCTGGATTTCGTATCGCGCACCACGTCGAGAAGTCGAGCGCTGGATCACAGGAGCCAGGATGGGGTCAATCTTCTCGCCCAGAT
TCTCGATCAAGAAGGCACCATCGGTGCCAATCGCAGTCTTGAGGCGTTCAATCCACATCTTCTGCCCCACTCGGACGATGATAAGGTTGTTGTGAGCCTC
CATCTCTCGAATCCAGGCGATAGCTTGAAGCTGAGGGTCCACAATTAGCGGTCGACGACCCATAGACACGGTAGTGACCACAATGGCACCATTCTCAGTT
GAAACGCGATCGGATGGGAGCTTTTGGGTATTCCACTCGGCGATTTGCGCATCGTTAGTCAGAATCAGCAACGGGTTGGCTTCTTCAGCCATGGCTATAC
TCTCTCCATTGGCGGCAGTCCGTAAGTACGGGACCCAGTGCTTGTTGATCAGTTCATCACGGAATGGCTTGGTGAACGGCCCGATGTAAGAGATAAAAGC
TGAAGCGAGTAGCACATCGCCCACCAGTAGATCTTTTTCCTTCTGAAGTTGCAACACGTTGATCCCCCACCGAACGTTTTCGCTTGATAAATCGTTCGTC
AGAGTGCCTGCAAGCTTCATCTTGCGGTTTCCGGTCTCCACGGCATTGATAGcatcttccttctccttctctgctgctgcggcttcaGCCAGTAGCTTGT
CTAGTTTCGCCTGTAGATCGGCAACAAGAGCTGTGACTTCAGCGAGACGAGCATTAGCAGACTCCAACTCAAGATTGGCAGCAGCTAAGGCCTGACGCTT
CGGCTCGACCGTGATGACGATGTCGTAGTACATGACGATGTTGATGACCCACGAACACAAACCAGCGGCAGCCTTGTTCTTTGTGAGGATCGTGTcgtag
ttgaagtgctccatctccaagAACACGCGCACCTCTTTCCAGTTCATTGGAGGCACCTTACCATCGTCCACCACTTGCTTGAAACCAACCAGATATTCAA
TGTACTCCGGGATATtaccaagaagctgcttcttcacggtgTCCCACTTAACGTCCTTCACTTTTCCAGTCTTGGTGACCTGAACGTTCGGATGTACACC
AGCTAGCAGGACCATCGTGGCTGAGAACACGTCATCTACACCAGCAGGAGGCTTCGACATGGTCTTACACTCGCCCAGAtccttcttgttcagcgAGTCG
AGGGCGGCCATTGCTTGCTCGACAGCAGGCTCGGCCTTGGCTAGATCCTCCTGTGTAGACCGCTGTTTCTCCGTGACTTCTGTCTGGATGATCGCACact
tggcagcttcgtcgccgGCCTTCTTACTTTCAGTTTCAACGTTAGCTTTCTCTTTATTGACAGCTTCGGCAATGCCAGAGGCTACTGCTTTCTTGTCTTC
AGCGGCCTCAAGAATgaccttcagctccacctcAAGCCGCGACACGGTGTCTCCCGTCtctttgagcttctgcaAACCTTTCTCCAGTCGATCAATAGCT
GCAGCATATTCCTCCACTTTCTTCCGCAAGATTTTCTTGTACAGCTGAAGCAATTCCAGATACGATTTGGGCGTGGTGTACACGTGTCGGCGCTCGACTT
GGAAGAACCTTTCCGCGCAGATATTCACCGACTGGAACGAAAAAGGCATGAACTTCTCAATACCAGCGCGTGATTCTTCAGATCCAAGTAAATCTCCAAT
CTCCTTGAGCTTTTCACGACCAACAGAGAGCAAAGCTTCTTTCGGCCACGGTTGGAACCAATCGATAACTGTGCAGTTCACAAGCGCAGGGAATTTCCGT
GCTCGGTTACGGAAGTCATCGCCAACAGGTGAaaagcacaagcacaagtGCAGACGCTTGCGGATTTCAGCTTGGAAGAACTTGATGACTTCTTTCCGGT
CTTTCGTACCGGCTACAGGTGACAGTAAGTTGACGATGTTGTCCATATCTTCCATCGCGAACAGGTCTGGGATCTCACCGGAAGCAAGTAGATCGTTCAA
GTAAATGAGGAACTTCTCGTTGGTAATCTGTGAGTCCGTGAGCATGAACACCacgcctccatcttcttcgttaCGGgacagcatctccaccaccgccatG
TGCATCTTACGTAAGTCTTCTTTGAATTCATTCTCTCCGTACTTGGAGCTGATTGTAATTTGCCGAACAGTGTAGCCGCAGATGTGCGAGGCCAAACGTG
CCAGCGAACGTTTACCACTGCCTCCCACACCAACAAGCAGTGCGTGGCCACTCTCGTTCCTCAAGATCCGAACGATACGCGCCACGTGCTTGACCGCATC
GTCGAACAGATCCAACTGCATGGCTGTATTGTtttcgttgttgttgtactcTCGCAACTGGACTTGTAGGTTCATCTTGAGATCGTCCAAGTTTGTGCCC
ATGATCTGGTCGTACTCGCTGTCTCCATCTTTCGTAAAATGGCAGAAGATAAGAGGCCACGAGTTCTCGGCCGCATAGTACCGACTCGTATTACAGGACA
CGAACGACTTTTTCACTTGCATCTGTACGAGCTGGTTGTACTTCTCGATATCAGCCTTGCACACAAGTCGGTCGCCGTACACACGTTCACTTTCGTGTAA
CCAAAGCAGAACAAACTTCTCCTGGCTGTTGAAGCGGTCTTTCTTGGACGCGATCAGCCCTTGGAACACGTTGGATAAATGACGGACGTTGAATTCATAG
TGGAAGTTGGCCGCAGTCTTGCGGAATGTGCTCACAACACTGGCATGAAGACTCAGTGCAGCCTTAATAAGCGCATTAGAGAACTGGGAGTTGCTTAATT
CATCAGCGAAACTCGACAGATGTCCGCCGAGGAACGTCTCGTAAATTGTGACCAAGCTTGGGGCTTCAGGCATGCCCATAGCAAAAGTACAGAAGTGACG
TTGGAGTCGCGGGTCAACCAGGAACGAACCTGCCGTGGGGTTCATACAAGACACCACCTGCGTGTTCAGGATATTCTGAGTCTGGAGCTTTACACGGTCG
AACCAGTGTCGGTACTCCATCACCTGCCTCAATAAAGAAATAGCGCTCTGCGTGTTGTACGGATCCACTTCTGGAAGGTTGAGATCGTCCATGAAGTAGA
TGAGTTTGGCCTTGCCAGGCGGGCCCAGATTGATACCAGTTTTCCGCTCCAATTGTCCGAACATAGTCTGCTGTAAGATGGCGCTCGTGGTATAAAAGTT
GAAATTGATCGTACAGTAGCGGAAAGCAGCCGTGGCTTCGTCCTTACTGAGCTTTTTCAGCATACCCATAATATTCTGTGTCTTACCTGTGCCTGCAGGT
CCACACACCATCACCGGCACATTCTTCGAGATAAGATTTTCAAGCCAGAATGCAATCGACGCTGTCTCCGTAGTAGGAACAGTGATCTGATTAATGGGAC
TTGGAGACACGTACGTCTCCGTGTAGAAATATGGACTCTTGGACCAGGAATTGAACTTAGAAGTCTCCGGATCCAGCCAGAAGTCGAAGACTGTGTTACT
AGCGGAAGCCACCAACTTCACATCCTTCCACTGGTTCTTCCACCAGTTGCTAAACTCTGCTGAGTAGTCCGTACCATCATCACTCATAGTAAGAATGGAT
CCGAAGGACCACACACAGCAGAATACAAAGGAGTTTTGCATCACAGTGTaatcttccagcacttgaggAGTCAATAGGCAGTCGATCATGTTTAACAAGT
TGGTcaccagcgtcgtctcctccactggCACTACAGGAACAAGCTTCTTGCGGAAAAACCTCAACGTTGTCTCTACATATTGGTCGAAAAGCCCTTGGAA
TTTGGCACGAGTATCTGGAGTAAACATCATGTTCCTCAAACGGTGATCAACGGGCTGTTGGCAGTGCCGATCCAGCCAGCTATCAATCAAGCAGCGCCAC
TGGTAGCCTTCCGACGTTGAAATATACAGGATACCAGCTCGAGACACTGTAGCCGGTGTAGCGTACACCAGATCTCGGATTTCAAAGATCATTCGCATGT
GAACTTTCAGAGGAATCCGCTCGTTTGAGGCCAGGGTCAACATTCGGTTATCGTCCATGACAGAGTTCATCGATTCAATCCAGTTCGCATCGAGATCTCC
GTCAAGAATGATCCACTTGGGGTTATTATCTTCATCTCCATTATCCCGACGTCGAGAGCCAAGGTCTCGCATAATACGCGAGAGCAAGCCATCTTTCCAC
TCGCGTGTTTTCAACACAATGTATCCGTATAGTTCATTCGTGCTCACGGATTTGGGGTTCAAGTCCTGCACTTCCATTGGTGTGCCCATGATCTCGCGCG
CTTTTCTTAATGTCTTCCACGTTTCCGTTTTACCGGAAGCAGGAGGCCCCATGACGAAAACACAGTGGCGAATTGCCAGCAGCTCTGATAATTGCACAAC
CTTCAGCATAAACTCTGGGCGAGGAGTGTTACCGATTGCTTCTGAAGCGCCCTGTACCATGGATTCAAGCTCCATGTCCCGCTTACGAGGAGGATCGTTA
CGTACGTCCACATTGGGACTGTCACGGGGGAACAAATCGCCTAAAAGACCAAAGAAGACCACCATATCTTCCGCTACGATCTTCGGGATGTTGAAATCTC
GTAGCGCACGCATGAGCAAGTCCGTCTCGGGGATATCTGGCTCAGCACGCTTaaaagcaccagcaacacacAGCACACTCTTAACCGCTCGAAGGCCCCA
GTCATAATGGAGTTGTTTCGACAGGAGCTGTCCAAGCAAGGAGTACAAGCCGTAAAACTTCGAGGCCAAGATCTTAGCCTGTGTGAATCCTTCGGCCATG
AGCATATTTTCACAGATCAACACCAAATCAGGCACCATGACAGTCATGGGGCGGAACAGTGCCTTCAGACCTTCAGGGAGCTCAGAGCGTCCTAGATAAC
CGGGGTTCATCGTGATAAACGCACCAACTGTCGGGTCCAGCATCACCTCATCATTCTCCAGGATAAATCGTTCATCATCAGCTTTGCAAGCATCGCACAC
GGCTTTAAACTGAACAGAACAGACCGAAAGTACCTCTGGCACCAGACGgttgaactcgtcgaagCACCCCCACGAACCAGACGATGCCAGACCTTTGAAA
ATGTTGCCAAGACTCTTGAAATCCATCTCGGGGGAGCAATTAAACACGTAACAGACTTTTCCGAGAGCATTCGCCAAATCCTTTGTTGTCTCCGTTTTAC
CAGTACCAGCGGGGCCAGCAGGAGCGCACCCCATCTGCAAGTTAAGAGCTTGAGTGGCAGTCACGTAAATTCGATCGGTCAGCGGGGTAATCACAAGTCG
AGGCCCGTTGCCGAGATATTCGTAGTCGTACGGAATACCAGCGTCACAGATGAGGATCTGCGCTCTGGCGTTATTCGCTCCACGGAAGGTGCTGTCTCGC
TTCAGGAagcttcctgcagcaggagagAAGTAGTGTTTGAGCTGGGACTGCCACTGGAAGTGAGTGGCTTCCTCCACTCCGGCTCGGATCATGTTGGCCA
CGATATCTCGACCGTGGGCATCCATCGTAATGAGGACCATCACACGCTGTCGTTCTGCATACGAAATGTTACTTTGTGTGAGTTTGATCAAgtcttccag
ctgcttctcttgCATCTTGTTGTAGTTCTTCAGAGCATCCTTCTCGCCGCTTTGGATAGCACGGAACGCACGCTCCACTTCCTGAACGTAGTGTACTCCA
GCCGCAAGCAGGATGATCTGCGCTGCATCCATGGGCTTGTTCGTGTCATCTTTGAAGTTGATCCAGTCCACACGAGGCATTTCAGTGTACGCTACCAGTG
AACGTTCGATGTGTTTGAATAGCGTTAATCTCATAGCACGCATGATCGTCTCCAAGTAAATTTCCGCCTCTCCTTCCAGTATTGGGGGCTCGAAGAAATC
CACAATCTCATGCCCCACACCAGCCACAAAAGACGTAGCAACCTGCCGTTCCCCTGGTCCTCGATCCACCAAAGTGAGAGTCTTGGTAGCCAGGTAGATT
TTGGAGCAGTGCGGCATGATGCGGTCGGGGTGAGACCCGTTCGACAGGATATCAAGCAAGTCTGCTTCGGACATGAAGTAGAAACGAGGAAATTGGCGAC
GACGCCCGTCGAGAAACTCTTTGAGGCGGTGCttgcacagctccagcttctctaCAATAACCTCCAGGCGCTTGATGAGTCCAGGCTCGGTACATGCTTC
CTGGACGTTAAGGGTTTTCCACGCAGTCTTCAAGATTTGGCGGACTTCTCTATCGATGTCTTCGAAGTCGGATGTCAGCTCCggcaactgcttcttcacc
tctTCGGACTGAATGAAGAGCGGCTCCAAGTAACTCCACGAGCGCTGGATGTCtcccagcaacagcacgaCTTCGTTGATCGACGAAAGCCCGATCTGAA
GTTTGGCAACACGTGGCTCGAATTCCGATTGATATGGGGAAGCACTCATACCTTGGACATCAATTTGGTGTgtttcaagcagctcgaagttcTCTTCGGA
GACTTTGAGAAGAGgaacgacttcttcttctgcagcgccaggGTTGTACGGCGACATTTCCCAGTTCACTTCCGCCCACAGCGCCTCCAGTTCGATCagt
cgaagctcgagctcttgctCTTTTTCTGCTTCGTAGCAGATTTCATTGACATCCGAACTGAAGTTGAAAAGATTCTTGCTCAAAATCAGCGATAACTTTT
GGTCCGGGTCTTCGTCTGGCGTAGGGAATTCTCCTGTATGCGCCATGATACGCTTCCAGTGCCTTGGGCGCATATAGCTGGACGACACGCAGCGGATGAG
AGGGTGGGTCTTGTCAAACGCCTGACACTCTGTCAAAATTGAAGTGTATGCGTCACTCCACTGGATTCCTTTAGGGATTCTCTTCAGTTCCTTTAACGCC
GACTGCACTTCAATCTGCAGCGCGTTAACGTCCACTTCCTTGAACAAAATGTCTTGAGTGGCTTTGAAAAACGCTTTTGCACGCTTAATAATTGCCCAAA
CGGTTTTCATCGCATCAGCATCGGCTCGTATGAGCCCCATCATGCGAAGCGATTCATTCATAAGCTGTGGGAACCCGAAAATGGAGCACAACTTGGTGTT
TTCTTCAcatttcttcatctccatgTTCCAGTCGACGAGATagttctcgatcttctccagacCCTTGTCAGGTTCCAGTTTAGAAGACCAGAAATCCAGC
GTTTTGAGCGTCTCTACCTTCTGTGCGATCATCTTTTCATACGCGACAATTTTCTCCTCTGTCTTCTCACTGAAGATCCGAGTAGGCTCTTGTGTGCGTT
TCTCCGTCACTGGGATTTGCTTCTCAACAtcgatgaagagcttctccatgttcTCGATCTCTaccagctccttgtcgaCATGGCCGCCACTCTGCTTGAT
GTTGAAGAATAGTTGTCGTACTTGGTCCAGGATTAGATGGTTCGTGTCTTTGTCCGTCTCAAGCTTGCGAATAATTTCTTTCATCTTTCGTAGAGTTTCC
AGTCCGTCTGTGTCGTTGTTGGGGATATCCTTCCTCAGATCCACAAGAATGCGGCGGAATTCTCCATTGCGCTTGTTCATTGTGGCCATCACACGCCTGA
TCAGCTCAGGTGAATCGAAGTCCTTCTGCGTAGCAAGAGGCGGTAGgcattttgttttgttttcaTCCGAAGGAGGTTGAAACTCTGCAGCGAACGGAGA
ACCACGAATAGGACCAGCAACACCATTAAAGGTGCCTGTGAAGTCCACTGAGATATCGTATTTCCCTGCCCTGGATGGCGTAAACGTCACCACGTAGGTG
CCATCGTTCTTGTCGACGATAGACGCAAcctgctcctcttctgcttgggGGTCATCACAGTACTTGAGAGTAATAATGAACTCGTCGCCCCCGCAATCCC
GAGGATTATCGTCTTTATCCCGAGACTGGATGATAAACGTCGTGGGTAACTCTGCCAAACAGTTATCGCTGAGAGCAGGAATTAAACAGGGGCCAAACGC
CAGCGACTTGGGCGCTGTGGTGACTGAGTGGAACCGGAAGGATGTGGCTACGTTGGTGTACATGCCTCCACTTAGCGAAACTCGGACTTCTGAAGTTAAC
GCTCCAAACTTTTCAAAGCTGGGAGCTGTAGCCTGGAGAACGGTAGGACTGagaacagctccagtgacaTCGACCGAACCTTTCGCAACTGCGAATCGTA
GAGTTGCGTTCTGGCCGGTGAAGTTGAAACCGGTGATTTTAACCCTCGCGTTACCTGTGATCGGTCCTTGCTTCGGCTCAATAGATGAAATAGAGTACGG
AGGTCCGACAATCTCGCTTGCATTAAGGACGTGCAAATCATTGTACCAGCGATTTGCCCACCCtccgaagaagatcaagtggTTGGTATTCCCATCAAAC
ACCATGGCCGTATCGGCTCGTGCCTTCGGGGGTTCTCCTTTCACCGGTGGATTTAGCCACACCATACTACCAGTGTCCAACACAGTAGTGCTATTCAGAT
ATGCCCCCTGCGCAGTTCCAGACTCAGCCAAATCTCCACTGTTACCACCAAATAGGAAGACCTTCCAGTGAGGTACAGCTGCCACGCTCACACATGTGTG
GTTCCAAATAGGAGAACTCAATGGTGTGCTCAGCAAACTCCACGTTGCGGAAGGCAAATCAAACACGAATATGTCTTGAAACTGCTTGAAGCTATTCCAC
CCGCCAATAACCAACAATTGCTCTTTCACCAAACACGTTTGGTGCCCCGAACGTGGCTCGGGCTTTTCCCCTTCAGTCTGAATTTCGTGCCACTTGAACG
AGTGTAAGTCCAACGCGTGGAGATCATTGAAGTCCGTACGACCGAAGCCATTGCCGCCGTAGCCTCCAAACACGTACATTTTTTCACCGACAAGTGTGGC
ACTGTGTGCACCGCGGCACTGCGGTAGCCCCTCCCAGAAGCCCTGCGCATACTTTTGCTCCCAGACCTTCAACTCAGTGTTGAAGAGCCAGAGATCGTTC
ATCCTCTTTTCAGCCGCAAAGCCTCCGAAGATGATAATATTCTTCTCAAACAGAATAGCAGAATGTCTCCAGCGTGGCGCTGGTacatcgtcgtcactct
gCGAGCTGATTATCTTGGACCATGTGTATCCTGCCAAGAAGTCAACATTATTTGGGTCAAAGGGTGGCTAGTGTGAGGTCAGGGAAACAGCACACATACC
ATTTGACACCTCCAGTCGGTAGAGTTCGTTTGTGGGTCCTGGGGGTGATTTGTGGTCGCATCCGCCAAACATGTAGATGGCAGCCTCCGATTCTGAGCTC
TTCAATGTGAAGGAATGCCCCGACCGCTTGACAGGGATCTCACCATTCTGCTTTGGCGCAATCCAAGCTAGCTCCGGTTCGCATCCGTACCCGATCGGCT
GTTCAGAAGGAACCATTGAATAACATGTTCAACAAGCCTGAAATCGTCAATGTCTGATGCAAAAGACGCACCATGCCAGCTTTGCCCTTGATAGGGTGTG
CCTAGATTGAAGCCTGTTGCTTGGGGAGGGTGTTCCCCTCGTACACTTTAGTTTTTAGTCTTCTCCTGGCTTGACGCAGTCGCCCTTTCCTCTGCAGTCG
CTATTATATCACAGGAGAGCAACAACAATCAGTCCATTCAAAAGGCGCGACCGGTAGCACAGATCCAAGATATCGCTGTCCCTTCACCATATCCGTTATT
GATAGTCCTGCCTGGCAAACACAAGCATCAGACTGCGCGTCCAGCATAACTCCCTGTTCGATACATCAGTAGACCATTTTGCTCAAAGCGCATGCTTTTA
TTTCGTTGCGGAATGCTCTGCAGTGCCGCCCTTCGATCTGCATGCTCTACACGTGCTGCAACGGGCACACAACAAACACAACCCACTCAACGCAAGAGGG
GAGGCCTCGGCGCCACAGATGCTCGACTTACTCAACACCACGCGCAGTTCAGCCGCCTAGTTGTTGAACTTGAAGAAAATAATGTCACCGTCCTGGacct
cgtacttcttgcccTGCTGTTTGAGCTTGCCGGCCTTTTTGACAGCCTCTTCCGTGCCCACTGTAACATTACGACAACATCCCAATGTTAGTCAATTAAC
AAGAGTagccagcagccacaaaAAGAGATTTGAACTTACGCTCTTTCAGGTCGGCGAACGCCTGGACTTCGGCCATGATGAAGCCCTTCTCGAAGTCCGT
GTGGATGACACCAGCAGCCTGGGGCGCCATACGACCCTTGCGAATGGTCCAACCACGCACTTCATCCTTACCGGCAGTGAAGAAGTGGATCAGGCCAAGG
GCGTGGTAACCCATGCGGAGCACGCGGTTCAGGATCGACTTGTGCGTCGGATTCTCCTTGAAGTACGTCTCCAGCTGGCCAGCAGCCTCAAGGTCGAGCA
actcgagctcgaactcgCAACTGAGCGGGATGACGGGCTCGTTACCGCCACGTTCCTTGATGTACTCGGCGATCTTGGGCAGGTACTTGTTACCCTTACG
CAGGTAGTCGCGCTTGCTCACATTAATGAGGTACACGACAGGCTTGGCGGTCAGCAGTTGCATGGTGTTGAGGATTTCCACCTCCTGGGCCGTCCAGGTG
CCGAAGGACACGTCCTTGCCGGACTCAAGCCACTCCAGGATCTTGCACAGAGCCTCGTactccaacttcttctccttaCCACCAACGCCACGCTCGGCAA
GCTTCTTGACACCAACCGACTCCTTCTGAACGCGCTCAATGTCCTTgagacgcagctcctcctggatGATCTTCATGTCACGCACAGGGTCCACGTTGCC
CTCCACGTGGGTCACCTCAGTGGAGTCGAAGGCGCGCACCATGTGGTAGATAGCGTCCACGGCCTGGATGTGCGACAAGAAGGCATTTCCCAGACcggca
ccttcagcagcgccgcgaaCGAGACCGGCAATGTccgtgatggagatgactGGGGGCACGACGCTGGTGGGCTGGTACTTGTCCACGAgccagttgaagc
gctggtcaGGCAGCGGCACTACGGCATCGTTGGGGTCGATGGTACAGAAGGGGAAGTTCTCGGCGGGGAtgtgcagcttcgacagaCAGTTGAAGAACGT
GCTCTTGCCCACGTTGGGCACGCCCACAATTCCGATCTTCACGTTGTTACCAGGACGTCCCAGGTACGTGCGCGTGGGCTGAAAGAAGAGGGTTATATCA
TAGCCGCTATTAGAGGGGGGTTAATAGGTCAGGCGGGGTGTAAGCGGCCGCGTACCTCTTCGGTCTTCTTTCCCTTCGGCGGCATGGTGTCGAGCTTCGG
TGCTGAGTCTTTGAGACAAAAAGCGAATGGCTGGTGCGCTTTGAAATTAACCCAAATCAGGATTAACCCTTTTCGCTAAACAATAGGAAATATTTAACCA
GTTTATTGTCGCAGAGACAGAAGAGAAGAGCTTTGGCGTCAAATAAAACCATGAAAAAGCTTCATTGGATGTGCTTGGGCACCGATCTAGACTAGATTCT
AGTGCATTtacagagcagcagagcttGCCTGCGTGCTACCTCCAGCCTTTACTTGCTGCGCCAACCTGTCCGTTTCtgtgaagcagaagcacaaCGTTTG
AGTATTGCGAAATAAATCAAGTAAATATGAGAGACTTACcagctttcttcttggccgcgGCAACGCCAAGGGCGATGAAGACCACGGCCATGACGCCCAG
GAACACACCGATACCGACGAAGATCGTCTGAGGGGCTGTGTCTGAACTGCTCAGGGTCGCACAAGAGCTAATATCCTTAACGCTGCAGTCGGTACCCGTG
TAGCACGACAAACAGCTGCACGACTTCGTGCCGTTCGACTCCTTGCACTGGCCATTGCCACCGCAGTCAGATGTGGAATCGCAGGTGCCACCACCGCTGG
TGACCTCGTACGTGCCACAAATGTCCTCCTGGGTCGTACCAACAGCTTTGCTCAGCGTCACATCGCACGTGTCGCCATCGTCCGTGCAGATCACGCCTTC
ACGGCTGGAGCAAGTCCATGAGTCGGAGCTCGAGATCTTTAAGTTGCTCGCTGAGCAGCTGCTCACGATCCAGCCGTACTTTGTTGCTTTCGTGTTGGTC
GACTGTGTCTTTGTTTCCACCGTAGGCTTCCACGAACACTTAGTGCTGTCAGTCCATTCTGCATCGTCTGTGTAGCCAGAGTACTTAGCGAACATGGCCT
TCAGGTTTGTGTAATCTGTCGAGGACTTCGAACTAGGGGTCGACAAGAAGTCCGTACTGCCACCTACAGCGTCGACACCACAGATTAGTTCATAAATGCC
CAAAGCATCACACAATTGAGCAACAGAAATGTCGTACCAGTAAACATCGGGAACAGCGAGTCCGTTGCAAGCTTAGCTTCACCGTAGGAGTAAGCCAGAC
CGCCAGACCACACGGCGGTAAACTCCTTGGTCTTCGAAGGCtcctggtacatgtacggaACCATTCCCCAATCGCGAGGAGTAGCCGAAGATGTCTTACA
GCCGTACTCGCCAAATGCAACAACAATGGGGATACCTTGTGCCATATCGATGTAGCGCTGGTACGCCTCAGCGAAAGTCGAGTCCGGGCACCAACGGTAC
TCATTGATCAAGTAGATATCAATACTCTCCGTCATCAGACCGTTGGTCATCTTGTCTCCACACAGCAATCCTTGGACCTTAATAACGTGGTAGTCGTCGG
CGTTGCTGACATCGTCGTTACTactgtcagcagcagcgtaaGCAAGCGGCAAAATTCGAATTTTCTTTCCGTTGACCGTCATCCAATTCTTCAAGTCGGA
CACGTAGGCTTTGACACACGAGGCAGCCGTGAGATCCCCCTGCATGATTTCGTTAGCCACAACGACGCCGAGCGTGTTGTCATACTGGGCAAAGTTCTgg
atgatcttcttgccgtaCTCAAGTAGAAGGGCCGGGTAGCACGTCTCGGTCTGGTCCACAGTCTTTGCACCATCACCCGACGACACCTTTCCAGAGCAGC
TCAGTTTCTTAGTGATCGTTGAGTAGCGGTACTTGCCGTAGTATGCGTCATTATCAGGCGAGGCGGAGACCATGACGTAGACTCCGAGCGCGGCCATATC
GCTCATAAATTTCTTGTATGACGACGTGGGGTTGATGTTGTACAGACGCAGCGTGTTATACTTGAGGCCCGCGAGGTTCTCGGCGATGACGGCTTTCGAG
TACTTATCATAGTAATCGTCGCTCACAGCGTATTCGTAGGTCAACTACAGAGCAGTACAGTAAAATACCATATTAGTCCCTCCCCGTCATATTCCGTGCC
GAACTGTGCTTTGCTGTTAGCGTTCGGCTCCTTCCTATCCTCTCGAGCCGTTCGAACATACCCCTTTGATGAAGAAACGCTCGCCCGTCTTGGCGTTGTA
GAGCTTGTTGCCGCGCACGACGATCACGCCGTCGACGGCCGCGCTTGCCACcatgtgctgcagcaacgcaaCGGCCACCAGCGCGGCCAGGAGCAGGAAA
CTTCGTCCGGTCATCGTGTCCGAGGTAGGGGCGAGTCAGTCGCGGCCAGGCAGTCGGCTTTTCACTATGAACGGCCGTCTCCTCCTTTCTAACAGCGCAC
AAATTTCGAGTAGATTTTTGCCAGCTGGTACACCCATAACAATATAAAGATTAAAAGCCAAGTTTTCACGTATCAGCTATGAGAGAATTAACACTCTGTT
TTGCGTAACCTGTTATTACTTATGTTTACAGAAGCATTTATTATTAAATGCTACAAGCTTATAAAACATGCGTGCGATGTGCTCGGAGCGTTGATTGGTT
GTTAATCATATAGAGATATGTGATTGGTCCGTAAGGATCGAATATGATTTGGTGAAATCTGCACTCTCTGATTCGCACCTACGGAAAGTATCCGTTCACC
AAATTCACTGATGGCGGCTGCAGAATTCGGCTATGCGAGTGTAGGCATCTGCTAGCACGTCGTGTGGCGCCGAGAACACGATGCGGAAGTAGTTTGTCAA
GCCAAAGCACTGCAGATACCACGTAGAGTCAGACAATTTGGCAGGTAGCAGAAGTTTCGGCTGCCGTTTCTGACAACTTACCTGTCCAGGCAATACAAAg
acggcttcttcctccagcagcttctgcgtaAAGTCAAAgtcgtccttgatcttcgATAAGACGTCGGTATCGATCTTTATCTACATGCAAAGGAACTTGA
TAAGTTATCATTCATTTTTCGATCGCCAGTTTCGGTGTGCTTACCATCGAGTACATCGCGCCTTGAGGAACCACCACCTCGAGACCAGAAATTTCAGATA
TCGTGTTCACAGTGAACTTGGCATTCTCCTCCAGGGTCGCGAAATACCGTTTCTTAAACTCGATCAAGGACTGCTCTTCGGCACTGCCAGGAACCGGCGT
AAGCAAATCAGGGATGGCACTCTGGTAGCGGGTCATCAACACGTTAGCACGGTTCTTGCAAGCTGGCGAAGATACCATACCTGGACAAGCGAGTTTGCTC
CAAGAGTACTTCGTGAGAGCTTCAAATAGGCAGTGCGTGCGTCTTTGAGGATGCCCTTGCAGTCATTTACCATGACCCAACCTACCCTCCAACCAGGGAC
CTGAAACTCCTTCGCCAGCCCGCCCACAGTCACCACCGGGACAGTTttcgccagcgccgccatggGGAAAAACACGTTGCTTCGAAACACCATATCACCA
TAGATCTCGTCCTGTGGTAAGGTATCTTGGACAGTGAGGTAGATTCATTCACGAACCAGGTGGAGGTAAAGCTAGCAACGTACCGCAACTACAGGGATCT
TGTTGTGCTCCGCCAAAGCAAGAATTTCTTCGAGATGAGGCTGCATGACGACGTTAGCCTGAGAATTTCATTAAAACACACCATCACTTACCTTGGAGTA
CACACTGCCGCATGGGTTGGACGGATTGTTCACCAGAATTGCCTTCGTTCTATCGTTAACCAGAGACTGCATGTGCTCGAGGTCAGCTTCCCAGTTTCTC
TCGGGCTGCGCCAGCACGACAGATATCAATGCAAAGCAATATCTACATGTGCAGCTACCGCAGAAGACCTACCTTCAGATTGTAGAACCTGCATTCAAAC
TCATTCTGTATACAGAGGGCTTGGTAGAACGGGAAGCCTGGCTTTGGGAGTAGAATGTTGTCACCGGGATTCAACAGTCCTCGAAGTACAATGTCAATAG
CACCCGAACAGCCGCTAGTGATGAGAATATCATCGGGCGTCAAGGGTGCCTTACTGCTGCCGTAGTAGTTCGCAATTGCTGTACGAGCTTCCTCAGAGCC
AGCAGAGTGTATATAGCCGTTGTGCTTCATCGACCTAAACGAGTTCTTAGCTATCAGTCTTTGTGTCTCCAACAACACCCAATTGTAGCTTACCGAGTGT
TGCGGACAACCGCCTCCACTAATACGTCGGGACAATGCAGGTTGCCAAAGACAGTTGGGTCACCTATGCAGTTGCCAGAACAAGATGAGTTTAGTCCACT
AGCCATCTCACATGTGCAGATACCCACCTAGAGATAGCGGGATCAAAGGCTTGGACGGCGTTGCAGGCTTTCTAATGTTGTCCACAATCTTCCGGATCGG
GTTGGTACATCGCTTTGACATTTCCGACGGCTGCACGCTCCACTGGACTTTagcttgctgcttggcgacGGTTTTGTCGTTCTGGGCCATATTGGTAGTA
ATACTCTTTGTGCTTGCCACACACACGTCCAATTTGAAAATGCAACTAGCCAGCTCCGTTTCCAAGACCCCTTATctaggggggggggggggggggggtc
aCCGCATGCATCACGCGCGGCTCGAGCTGTCCTATGGGCAAAGGCATCGTCCATGACAAGTGTCGGTGGTAACCAATCAGTAGCATTTATTGTGTGACGA
TGGTCG