Description :
From Genome Similarity Track
Location :
scaffold_12:14593- 15607
Sequence
1014 bases(100 bases per row)
gcacgaaaatcttcaacgtgaggcagtcggcgcACAAAATGCTCCAATCTTCCGAGGCTTTCCGctcagcggtatgcgacctcgaaaagatgctcggcag
ggtgccgatgacgacgactttgtcctccaaagctcgaagagcatcgcgagcaACTGGACAGCGATTGACCAAATCGTCACCGTCCGCCGTCGACACttcg
acgagaacggtggtgtccactaacATgtgaaacgtcttgtggtttgacgtcgtcgacagggtcaaacccagtatctggtgaagtggcgggttGCCcagac
tccgagaactcgtgagagcttgAGGTGTCACTTCGgtaagactgcccagacgtcgtgggcgCTCATGATCGAAGGGATGGGGTTGACCATGTAGACGCCC
AACAattgagtgatcgcgtcttttgcttctgtagtgggatccgccgagcggaagccgtatctAACACGGAGGTCTAGGACCGTCCGTGGATgcgagcgca
ggagagccgccctgtgggcagccgcTAACTGCTGCTTCCGCGCCTCGTCGCGATAATTGGTACTGATACCACTTTCTTCGGTAACCGAGAGATTGGGGGA
AACGTCCATGGtacccgcaaggttcgagcagggcacACGACGTGCCGCTAGtacacctcgccctcctcttctttccatcctaGAAATGGTTTCTTGCCCA
CAAGTAGAGCTGTTGCGTCTTAAATTTGCGTCAAGTTCATCCGTACATTCGCTGCAATCAGCTTGCTAGCCAAGTCGGCAAGATACCAGTGCCGACATGC
ACAACGATTACATCAGGCTCTCTTAGTCTACCAGTAGGCTCCATAACATCGTATTTTTCAATCAGCTCACAGTCTGCGTTACTTATCATCATCACAAGCT
TCTCTTACTGTGATACGTGCGTATTCACGGATGTGTCGTGAATTCGAGCGATGAGAGCATTTTATTAAGCCACAAACGATTTACCGCGTCTTGCGTGTTT
TGGAGCGTCTTGAA