Description :
From Genome Similarity Track
Location :
Scaffold_688:14590- 17897
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_688-snap-gene-0.7ATP-dependent chaperone ClpB
Pytir_DAOMBR486maker-pir_contig_688-snap-gene-0.5Serine-rich protein

Sequence
3307 bases(100 bases per row)
CCACCACGCGCTTGTGCTTGATGCTCTCGGGCACTTCGCCGAGCGCGATGCGCTGCGCGAGCCCCTCGGCGATCGCGGTCTTGCCCACGCCCGGCTCGCC
GATGAGCACCGGGTTGTTCTTCGTGCGGCGCGAGAGGATCTGCACGGTGCGGCGGATCTGCTCCTCGCGGCCGATGACCGGGTCCAGCTTGCCGTCGCGC
GCGATCTCCGTCAGGTCGCGCCCGTACTTCTTGAGGCTCTCACCCGGCGGCACGTTCTCTGGGTTGATCCACGATTGCCCACCGCCGCCGCCCATGCCGC
CCAGCGACGCAAAACCGCGAGAGACGTGGTGGCTTTGGAACAAAGGCGCACGCTGGTGCTGCTGCGCAAGGAGCAGCGCGCGGCTGCGGCCCATGCCGCC
TCGGAAGAGCGCACGCGTGAGCATGATAACGTAGGTGCAGATTTGTGTGTGGCTGTGTGGTTCTGCTGTTTGCGAGAGAGCGAATTGCCAACTGAATGGA
GCTGTCCGTCACGTCCCGTCACGTCACAAGATGCGCATGTTCGCGATTGCTCGGAATGAACATTCCAGATCAACTCGAAAGAGTGTTAGAGGCACGCGCA
TAGTTGGCGAAATAGTTATAACGCAGTACAATTCATGGCACACTGTACCAGTATCACAATATCGACATCTCTCTTTTTGACAAGTTGAAGCCAACCCTAC
GTGAATAAGCTCGAAGACCTGCGCGGGTTCATCCAGACTCGAGCAAAGCCGTCGCACCGAGTGACGAAGCGACCAGCGAGTGGTTTTGTCGCCGGCAGTG
GTGTCTCTCAATCAATCCCGATTCGGAAACTCCGCCCTCTGCAGGTGGTGACGGCGGAGGAGCACAACGACGACCTGCTGGCCAAAGTGGACGCTGCGAG
CGCAGCTGCGCAGTCGTCGTCGTCCGCCTCTTTACTCTCGGACGAGGACAAACTCTCCGAGTCGATCTTCAAGATCCACCCAAACCTGCGCAAAGTGGTC
GAGTTCGTCGTCGAAGTGGTCGCGACCAACATCTGTGAGTACGTACTGCAGCAGATCGTGACGCCGAGCGCCGACGCGTTCATCAGTTCATGCGTCTCTG
AGAGCGGGCTGAACCTGCGAGAGCGTGGCGGCAGCTCACCTGTAAACGCGGCCGAGCTCGAGTCCACCACGATCGTGTTCCTGCAGCTGCTCGAGAACCG
CACGACGCGCACGATCCACGAGAGCGTGGCTGAGTCGCTTGCGGAGGCGAGTCGCGTATGTGAAGCCAAGGTGCGCGCGTCGATTCCGCACTTGATCCCC
CCATCGTGCCACCCGACGCTCGCCAAGTCCGTGATGCTGGTGGCACTGAATCGCACGCGCGGCATCGTGAAGAACCTGATCCCAAAGAGCTCCCGCTCCG
AGTTCCTCAAGCGTGTCGCGTTCCGAAAGAAGGTGATTCTGAAGGAGACCGCATCCAAATCGGCGGCGCAGGCGAGCGCTGCTGCTGCTGTTCTGTCGGC
CAGCACCGTTGCGGAAGAGGACAACGTGGTGCGCACACTGTCGACCATGTTCGACGAGCACGCCGGCGTGGAGAACTCAAATCAAGATGACCTCCTCTTC
GCACTCAAGCAGGCGAGTGCACAGATCTTCAAGCTCAGCAGTACACGGCGGTCCAAGGCCACTCCGGATGAGTGGACAAAGCTGCACGCGTCGCTTTCGC
GGCATCTGCGCTCGTTCATCAGCAGTCTGGAGGAGCTGGAGAGCGAAAGTCGTGGAGCTGGAGACGCGTGTCCTGAGGACGATGTTGAGGACGGGGAAGA
AACCACACGACGAAAGCGCAGGAAGATTCACGAGCTGTCAGTATGGGATGCGACGTGGCGCGTGCTCATCTCGTGCCTCCGCGTGGTCACTGGGTTGACG
CACAATGTGGTCGAGTGGACAGGTTCTGAGGCATCTTCCGTTGAAAAGCGACCCGAGTCGTCCACACACGCGCTGGAGAAGACTGTGAGTGGCTTTGTCG
ACAACTTTGTCGCGCTTCTCACGCTGGTGCTCGTTGGCTCTCAAGAGGCTCCTTTTTTACAAGCGAACAAGGAGAAGAAGAAGACAGAAGGCAGTGGCGA
TGAGGTGGAAGCGCGTCGTCTCGTTGGTCTCGTTCGAGTCGTCACCGACTGTCTGCTGGCGAAACCTCCCAGTCTGAAACTTGATAACCTGGAACAGCAG
GACCCGAGTGGGCTTGTCCAACGCCTCGTGCTGGCCCCCCGAGTGCGAGTGCTGAATGTGATGGCGTTGTTTGGCGCATCTCCAGATTTCGGTGGAATAG
CGCTGACTTCGCTTTCAAAGGAGTCACTACTTTCCCGGCAGAGGCGATACAGCAACCAGAAATCGAAAATCCAGGTCGAAGATGGCTTATGCGAACAACT
TCGCCTACCAAGACAAGGCTTAATCAGGGTTTATCAGATTTGCATCGATAGATTTGCTTATATAAATCACGTTTACAAACTCTCCTTTTCAAAAAGTGCC
TCCAAAGGGTTTAGCAACGCAGTTTTAGTTTACCAAAATAGTTTAGCAACTCAGTATCAGTTTATCATTCCACACTCAGATTCCAAACGCTTCCTTAAAC
ATATCGACGATTTCTAAAGTACTCTAAATAAGGGAGGAAAGATGGGTGCAATATCACAACAAATTTAAAATGAGGAATAGGAGCATTTTCAAAGTAAGCT
TCTGAAGAAAAAACGTAATTAGTCTTACGCCTTAACCCCATTCCCCGATGTTGTATCTTACAACATGTCGTTGTTTCACATGTTGTGCCTATTGTGCCTT
TCTGTCTTTCTGCGGTCACGTTTAGTCTATCTGATCGGACTTGATCACTCCCATGAGAATTTTTAAACGTTCTGAGACCAATGTCTTATTTCCTCCATGG
TAGGGTTATTTACCGCGAGCGGGCGTGCTTGCACGAGGGTATGTCTACATATGGGGTGAGATTGATTGACTGGTCACACACAAAGGAACAACAAAGCCCC
ACCGTCAACACACAAGCACCAAGGTGTCGTCATTAGTTTCAACGAGTTTAAGGCCGCACCAGCCAGCAAGCTCTCACACATAGGGTTGTGGAATGTGCTG
CTCGAAGTGTGCGCGCTGCCATCGCTCGCGCTTTTGATTTGAGTGAACACTCACACGCTCGTTTTTCTTTGAGTAGTCGAATAGGGAATTGCGCTGAATA
TGAACAGACGGCGGAGAGTGCGTGATACTGGTTTCTTTCGGATGTCATCTGTTGTCTCTCCACAGATGGACAGGTGGCGAGTGTAACCGGGCGTACCCGA
GTTACGC