Description :
From Genome Similarity Track
Location :
Scaffold_450:1459- 9387
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_450-snap-gene-0.18DNA ligase
Pytve_DAOMBR484maker-pve_contig_450-fgenesh-gene-0.1Ribonuclease H2, subunit B
Pytve_DAOMBR484maker-pve_contig_450-snap-gene-0.19Intraflagellar transport protein 25
Pytve_DAOMBR484maker-pve_contig_450-snap-gene-0.20Tripartite motif protein TRIM33 beta

Sequence
7928 bases(100 bases per row)
CTAAATGAGCATGTCGTCATCTTCGTCGTCGTTTCCAGCAGAGACGGTCGTCAGTCCTTGTGCGCGGTACAGATCGGCAATCTACAATAGCAACAAACAG
CTCGTCAGTCAGCAGGTGGTCTCGACCAAAGTCAGCAGCAACAACGAGACGGTACCTGTGCCGAGTTCGTCGCCTGCGCCGGGGTCTTGTCTTCTCGGAT
GCGGATGAAGCGAGGAAACCGCAGAGAAATGCCCTTGTCGCGCGCCACGAGACCCACAGCAGCCATGTACTTGGGCGAGATGGACAGATCCGCTCCCAAG
ATCTCCCACACGCAGCTTGCCTCGAACCACACGTCCGGCTTGATGCCATCGCCGACCGCGTAGTCGCTCGGCGGCTTCGGGATCGTCTTCTCCTTGAGCT
GGTCGTAGAACTGCTTGAGCACCTCGTCCGACAGACCCGTGCCGAGCTTGGTGATCGGCTGGAACATCTCGGTGTCTGGGTCGTAACATGCCAGCAGATA
CGCGCCATACACACCCGTGCGCTTGCCTCGCCCATAGAAGGCGCCGATCGGCACGAGATCAGTCGAGTCGCCGATGCCGTCGAGGTAGTCCTTCTTGAGC
TTGAGCCACTTGTGTGATCTGTTGGCTGGCTCGTACGTGGCCTCCTGCTCGAGTGTCTTGACCATGAGTCCTTCACAGTTCTCGCGCACGGCCTCCTCCA
AGAACGTGCGCACTTTGTCCACAGCCACCTCCATCGCCTCCGCGTCGTCCTTCTTCATGTCCGTCATGTCGGTCACGTCCATCGATGATGCGAATTCGAA
GTGGCCAGGCTCGATAGTGAACATATCCCGCAGCATCTCGCGGCGCTTGGTCAGTGGGGTCGTCAGACACGACTCGCCGTTGAGGAAGAGCAGGTCGAAC
GCGTAGATGCACACAGGAACCTTGATGTCCTCGACCTTGACGTTCTTGCGCGATCGCGTGCTCAGGATCTGGAACGGGAGTCGCTTGTTGGTCGCACGGT
CCACAGCGACGACCTCAGCGTCCACGATGCAGCTCTTCACGACCTGGTTCTTGGCCTTGGCGATCATGAGCTTCACGTCCGGGAAGCGCTCGGTCGAGTT
CTCAAAGTTGCGCGAGAAGATAGAGATCTCGCCGTTCGGCTGCACGTGGATCTGCGCGCGCTCGCCGTCGTACTTGTACTCGCACGTGAACGGCTTGCCT
TCGAACCGATCGAACACCATGGCGTACGCCTTTGTAGGTCTGGCGAGCATGGGAGATACCGGTGTGCCAGGTGTGAGGACGCACTTGTTAGCCACCGTCT
CAAAGTCCTCGAGTCGGAGACTTGGCGCTGTGGGGACCTCTTCTTGTACCGATCGGAACGCAGCGACCAGCGCATCGTAGCTGGGACATTCCGAGAACGA
TTTCTTGACCCAAGCGAGTGCCTGCTGCTGCTTCTCCTTCTCCTTGCGGTCCTTCTCCAGCATGAACGCGTATGTAAGACCGATGAGAATGGACTTCTCG
GCGAGTCCGATGCGCAGCTTGCCCTGAAGACCACGGATGATGTACTTGGCGCCTTCGGCAGTCTTTTCTTGCTCGCTCTGTGCCTTCTTGTCTTTCTCGC
ACTTGACGAGCAGACTCTTGATGATGCTGCACTTTTGCTGCTGTGAGTTACTGCCCGTCATCTTGGCGATCTTGACAAACTGATCGTACACGTTCTGGAC
ACTCAGCACATTCAATTTGGCGCCGTTGTTCGTGGCGGCGGACGCGACTGGTGCAAACGACAGCGTGTGCTGCTTCGAGCGCGCGTTCTGCGCCACCTTC
CCCAAGTCACCTTCTTTGTGGTACATTTCCTTGACGAACTTCAGATTTGTGCCAGTAGCTTCGCCGATGGCCTTCATCAGGATGGCATCGCCAATGCCGA
TCTTGAGATTCTCGAACGGCGGTCGCAGATCCGTGCACACGCACAGGTAGATGCAAGCCAGCAGATCGTCCGGCGCGTCCCGAATCACACCCCGAAAGAA
TACAGTCAGCAGATCCTGAATCTCCAGCCGAGCCGACGTTGCCTCGATCTTGGTGAACAGGATCGCCAGCGACGCGTACGGCACATAGCCCAGATCAGCA
ATAATCGACTTTTCGTCGTCGTCATCGACACCATCGGCACCATTGGCAGTCTCATCGTCAGGGTCTTCTTTGGTCTTGGTCTTGGTTTTCTTCTTCGAGT
CGGGAGTTGCCGACTCTTTCTGCCGGCGCGGTGGCTGAGCCGAGAAGAAGTCTGTCGACGCTGTAGCGCTCTTCTTCTTCTTCTTCGGCGTTGCTGCCTT
TGCCTTTTTCGTTTCCTTTTCTTCGACGGCCTCTTCTTCAGCATCATCTTCCTTGTCGTCGATGTTGTCATCGCTATCCGCCTTGTCTGATGCCTCCGGT
TCACTGGAAGCTGCAGCTTTCTCCGGAGATACCAGAGTTGCTGCCGTCTTCCTTGGCGTCGCCTTCTTTGGCGACTTGGCAGGTGAGGGCGATGAGATAT
CGATTACGTCGGGGTTTTTGGAGTTGTTGGCGCTGTTGGTTTTGCTCGGAACGCTTGTGAATGGCAGATCAGCATCCGAGTCGCTGTCGTCACTGTCTAC
CACACGCTGGCGGAGGCGTCGACGGCCACCTGCAATATATCATGCAAACCTCTGTCAATGCTGCACCATACATGCCAGAAATCCGATAGACGTACGTTTA
GGCTTGGTTTGCACAGGCGACGCGACAGGCGACTTGTCCGAATCGCTGTCACTGGAATGCTCGCTCTCGCGTTTCTCGGCGTCTTCCATGATGGCGTCCT
GCTGAACAGGCACCTCTTCCTGCTCCACCTCTTGTTCCTTCTGCTTTACAGGTGTCGCCACATCCTTCTTCGGCGCGCGCTTTGGCTTCTTGCTCGTGCT
CTCAACCGTTTCTGCTTTGGCAGCTTCATCGTCAGCTTTTCGCTTGTTCTTGGCCGGTGAGGGAGCCGCTGGCGAGGACGACGCCCCGAAGAACGACCTG
CGTAAGAGCATCGATCAAAGGGCACACAGGCAGACATACACTCGTGAGTCCTCGTTGGATCTATCGATGACCTAGATGCTGTTCAACATTGCAGCAACTC
ACGTGATCGAGCGCTGCTGCTTCGCTGCTGAAGCGGAGCCCGTCACCGACATTGAAGCACATGAACGCAATCGCAAACAGTGTTAGCCACCTCCCCCGCA
TGCTCGTGCTCGCCCAGAACGTACATTTGCCGGCCATCGTGCGCTTGGCGGATTGACCACTTGACCCAGGCAGGTTCGAGAGTAATGACAAGTTATCTCC
TCGAGTTACACAGTCCGTACCCCATACAAACACGCAGTACACGAGATGGAGGAATTTTGGCGCCAACCGACAGGTTACTCGGGTTACGGAGCTGCCTCGC
GCCAAAAAGATAACTGCCGACGACAATCACTCTCATTCGTCCAAGTGAGCCATTCGGTCAAAGCAATGGGACGCAAGCTGCTCGCGCTGGTGCCGGCGCA
ATCGGAGCCGCCCGTGGCGCTCGAGCGGTTCCACGCGGACGCGACCGAACATCCTCTGTACACGGTGGTGGCCTGGTCGGCGCGGGCTCGCAGTGGCAAG
GACTCGAGCGACGCGGTGCGCAAGAGACAGCTCGCCATCGCCAGCGGCGGCCGTCAACTGCTCGAGCTGCAGCGCGTGCAGGCTCCCGAGGGCTCGCGCA
GCTGGTTCGTCGGCAATGACGTGCAGCAAGGTGAGTGTCTTGCAGTTTGCGACTGCTTTACTGAGATCTGACAGCTACTGGCTCGGTGTAGACGGCAGCG
TGCTGTTGTTTTCTCCCATCGACCCGCTCTTTGTGCTGCTGTCGTGCGTCTGGGAACAGCGCACGCGCTTCATGGCAGTCGACGACCTCCTCGCGCAGCT
GCACAACTCGTGGCTACTGCAGCTCGAGGCTGTGTTGACGCAGACGCGCGTCGAGCTGGTGTGCGACGTTCAGCTCACAGACAGCGACAGCTTTGGCACA
ATGTACATCAAAGCGAGCGAAGCCAAGATCGACAAGTGGCTCCGTCAAAAGGTGAGGACAATTTACACAACCACTGTCGATGAATGCTACTCACGATGAG
CTGGCAGGTTGAGCGGGTCGCACGCGCTCTGGTCGAGCAGGAGCAAACCGCGCGAGCCACAGACAACGGAGCGTTTGACGCAAACTTTCAGCTTCCAGGC
GCTGCAACCACCAGCGTCGAGACAAAGCAAATCTCAGCCGCTGATCTCTCGCAGCAGATCGCTCGTCGGTATCGTGACGCCATCGACATGATTGGCGACT
ACCTCCCTGGCGAGTGGGTCGAGCGGCTGTACACCGCTTTCAAGTACGTGCCGTGTCTCGAAGCCCATTGACACAGCTACATTACTGATGCTTGTGATCT
GGTATGATAGTGTCAAGGAAGTGGAACCGGAGACCAAGACACCGGCGAAGATTGAAAGCACACCACTGGAGGATATCAAGCGATTCGACCGGCGACGTGG
GGAGAATACGTCGGCAAAGCGCGCGACTCCGTCCAATGGCAGCGGCAGCGCCTCCAAGAAGAAGAGCAAGCTCGCCAACGTCGATCGCTCGGGGATGAAG
TCGCTCACGTCCTTCTTCGGCAAGAAATAGACCGGTAATGCACACCGGATGGGATTGCCGTCCCGGTTCATAATGGTATTGCGAAAATATGTTAGCTCTG
CTCATCGCATCGCTGCTGTCTATCGTCATCTATCGTCGCGCCGTCGAGCCCTCGACGCTCACACGGTGTACCGAGACAAAGTCGTTCCAGCCCGAGAGAA
TCTTGAGCTTGACGAACGACGCATCCACCGGCTTGACTGTCTCGCTGTCGAGCTGCACATTGCCATCGTTCTCGTTCAGCTCTGCCAAGACAGAAACACC
TCTAGTATTAGGCGTGGAATACAATCCAGGGATGTAGTCACCATCGGTACTGACTCGAGTCGTAGAGCTTCTCCCACTTCGTCGGCGTCGGCCCGCTGCA
CACCTCGACCGCCACCTCCTTGGCGTTCGTGCTCCACGTCTTGACGCGCGAGATGGACGCCGTCGTCGCCAGCTGCACGACGATCTCCTGTGGAAAACTG
CCCGTGGTCATCCACTTGGTCGTCTGGTCCCTGCCATCACAAGTGTATCTTAGCTAGCTGCCGAGACACCTCGACGATCACCACATCGGTTCCTCACCCG
TCCAGCACATTGGTCGGCGGGAAGTCGACGTCGAACGACGTCACGGCCGTCACCTGAGCGCCTTCCTCCTCGAGAGCCAAGTCCATGGTGAGAGCTCGCT
CGGCTGCTTTGCGCTCGAGACGGACGAGGACACAGTGCCAGCCACACTCACGACGACGAACGAACGCCACGCCCCGCTATTTTGGCGGACCGCATCCTGC
TCTTCGGATGCGGTCGCTTAATTTAGAACGACACTCCGACCGCTTATTAATACCTACGCGAATGCCGCATGGTGTGTGGTGACTGCGAACTCATTCGTTT
GCAGCAACACCTGGACCGTCGCTTGCCGATTGCGAGACTGCGTTGACGATGGTCACTGCAGCGTCGTCCCTCGCGCTGCGTACCGCGTCGATCTCGTCAA
TTGTCTTACTCGATTCGGCAGCAGTATTTCTGGAGGCACCACTGTCAACGGCTTCCGCTGCGACGCGACTTGACAACGATTGCGCGTCGTTGGCGACTCC
ATGATTCTCCTTCGCCTTGGAGACATCCTCCCCATTCGACACTGTCGACTTGTGTGTCGCTTTGGTCGGCCTCTTGACCAACTCCAGCAGCCTCTCAAAA
CCCGCGGCCAGTTCGTCTGCTGCGCGCGTGATGCCAGAACCGTCGTCGTTGAACAGCTTGCAGTTCGTCCAGATCAGTCGGACGTCGTTTGCAAAAGCCT
CGGTGTTCATTTGGCCTTTGAACCCGCCAGCACTGCCAGGGCTAGACCGCTTGCCAGCCGCATACGCATTCTTCTTCAACTTGGACGCAATCGTCGACAA
GTCCATGGGCTGCTGGACAATGTCCTCGTAGTGCGGCACGTCTTCGACGGGCGACAAGAACGGTCTCGCGAATGGATGTGACTTCAAATCCTTGATGATC
TGCACGCACTTGGACAGCACGTTGCTTTGGAGCTCCACGTTCTTCGCGAAGGCAACAAAGTAGGAAGGCTTCTTGCACTCGTTGCACTGCCAATCGCCCT
CTGGCAGGTCGTCTTCGGTCATGTCCAAGCACGCCAAGTGGAACGAGCGTGGGCACACATCGCAGCATACGAGATCGCCTGCGGTCAAACACACCTCGCA
ATAGTCGAGATTCGTGTCTAGTTCATCGTCGTCATCGCCATCAGCGGTGTCCACTGGCGCCTTTGCTTGTACCGGCATTTTCGTAGCTGTGCGGTTGATC
TTCTTTGGCGGAGATTTCTGACTCTGAGAAGGCTTCCGAGTGGCGTTCGGAGTAGAACTTGTATCCGCTTCAGGCGAACTGCTCGATTTACGCTTGCGCG
TTCCTGACGATGCTGAAGATGCCGGAGAACTCTTTGAAAAATGGCGACTTCCACCATCAGCAGTGTCATCAGCGGTTTTTGATCGCCCCGACTTTGCAGT
CTTGGCGGATTTGTTGCCTCGAGCATTTTTGATTGCGTGTCCATCCGAGTCGGTTGTGCGGGGCCGAAGCGGTGCGTCATCGAGTTCATCGTAGTCGTCA
CGAGGTCTTGGGATGCGGCGGCGACTGCGCGACGTGCTGAGGGTGCCACCGGGACTCTCAACAACTTGGTAATCTGAATCGTCATCATCGTCGCGATGAT
GCTTGTCGGCTCTATCATGGTCATCCGAGCTTCCCTTTCTATCTCTCTTCCGCTTCGCGGATCGCGCATTGTTTCTCGCTTGGGCTGAGTCAGTCAAGCG
TGTGTCTACTGTGAGTCCTGTCGGCGGGACAAGAGTTCCAGTCGACGGTCTTGATGGCCCTGCTTGTTCGACACCGATATCACCGTTCTTTCCCGCAGGT
CGAACGACAGACGCAGCATGAACAACTTCAGATGACTCGGCCTTGTCGTCCGGAGAAGAGTCTGACGATTGATTCAGCGACGACAACAGCTGAACCAGCG
ACTTCTCCGATTCAGCACAATTCATCACATGTGCTGCAGACGGCGATGGGGTCGCCTTCTGTTCACCAACCTGGTTGCTCCGATTGCTTGACGGTCGATT
GTCGTGACGCACAACATCTCGAGTGCTTGGGATATCAAGCGAAGGAATTGTCTCCTTAGCTGCGCGCTTGCGTGATGGCATCGAAATCGAACTCTTCGGT
TCAGACAGCAGTGGAGGAACTGGACTGCCAGCGTAATGTTCGGACTTGTCTTGGGAAAGGTACGGTAACGGAGGCACAAATGGCGGTCGACTCGAGTCAT
CTTCGTACACCGGGGGTGCTGGATGATCCATCCGTCGATGGTTTAATGTGGGGACCATCTCGTGTCTTGGCAATGGCGGCGGCGGAAAATACTCGACTTC
AGGCTGCGGGGAAGTGGGTCGGTTGCTGCTATATGCCTGACCCTGCTGCTCCTCGCGCAGCCACCGGCGGTACCGATGGATCTCGTGGTCCTTTTCCAAC
ACGCACATGGAGCACGGGCACGTTCGACTGCACACCATGCACTTGAGCGACCGGCGACCAGCTGTCGGTCGGTTCTTGCCTGCAAACAGATCCTCAGTGC
GCACGCGGTAGATGCTGCGCAGGTGCTCGCGACAGAGCGAGTGGCCTGCGTTGGCGTCGGGGCAAAAGTTGACAACTGGCACAAAGTGGTTCTCGCTCAC
ACCGCAGAGGTGACAGAGCCCCTTGGCGATGAAGCAGCAGTCCTGCTCGCTCACCATCTCCTGCACCGCGATCGAGAACGCCTTGCGCAGCATCGCGTCG
TCCAGCACCGCCTGGTCGCCGAGCACTT