Description :
From Genome Similarity Track
Location :
Scaffold_1543:1459- 3176
Transcript NameFunction/comments
Phymu_g13396hypothetical protein PHYSODRAFT_247318
Phymu_g13397hypothetical protein

Sequence
1717 bases(100 bases per row)
AAGCAGCGATCCGTCGGGTGACCTCCCTTTCCACACTTCTCGCAGGTCAAGCGATTCCTGCAATCCAGATCCGTATGCTTCCTGGATCCACAGTGCGGAG
AACGACCTCGATCTTGGTGATTGCGATCCAGGGGAGTCCGGTGATCATGGTTCCGGGTTCGATTTTGCATGTTCGGGCGAGATCGTGCGGGATCTGGTTG
GCAGGACCCTCTCCCAGCACCGATCGGCTgatcttcagctgcagctggataAATCCGCCGTAGATCTCCTTCAGAGTCGGATCCATCTGATCCAGACGCT
CCCTCTGACTCTGGACTCGGCTCAAGAGCCTGGATCGCGCGAACCACAGAACTGGCGGGCGCTGTGGGCGTGTTCGACGGAGACTTTTGTCGATATTTCG
ATCCGAATGCAGAACGTCGTTGTCTGCTCTTTGCTCGTTCTCTGGCGCGTAGAATCtcttcgagatcatcgacatCACTCAACCGGAGCAAGGTCAGGCG
ATCGGCCAGCTCTGGATCACCCAAAGTCTCGATGAAGTGATCGACATGTTTCCGGCGGGCCTTGGGATTTCCATCCTTGATCTTAAGCTTAGCTCGCAAG
GCGGACACGTTCAGACGTTGCAGATAATCGAGAGGGGTTTCTTCTGATTGTTTGCATGCGTGGTAATACTGCCACACCACCGACACCCCTAGATCGAAGT
GTTGGGTCTGGAAACTCTCCAGCAGATCTGCCTAATTGGTCTTAGTCGTTCGACTCAACTGTCGAtaccagttcttcgctggGACGATCATGAGGTCCTC
GAAAATGAGATAtttctcctcctcagtgGCCTGGTCTCGCTGGAACGCGGACTTGACCTTGCCGATCCAGGCCAGGGCAcgatcttcatcgagatcTTTG
CTGCGAATTCCTTCAGATCCGAGTTCGCCGAGATCCGGACCCTCTGGATCATCGACGATCCTCCTTGCCCTATCGCGGCTGAGGCCACTGCTGCCTGGAC
CGTGGTCGCTCTTGCGAGGCGCGCGATCCCCAGATCATCCGGGTCATATTTTGTTGATCTGGGGTTCCGACTGACTCCATATCGACATCCTGCGCCCCAT
CTACTTTGGGAGGTTGCCCGATCTAGGAGTGGCTAGACTTTGCTCCTTCAGGACCCGATCCATAGCCATCTGAAAGGACTCGTCCAACTTGTTACTGGAT
CCCGTCGAATTGGTTGTCAGAGTAGCTAGATCTGTCGGAGTCTGGCGATTCTCTCGCCGATCCGGCGTCTTAACGACTGACTTCAACCCAGCTGATCGTT
GATCTTGCTTTATCAATGCGTGATCTCAATGATTTGGCTCCAGAAGGACACAGATACATTCTTTGCGGCCCTCGGGAGCTATCGCAGCCCGGCTCTGAGG
CGACTGGCGCATAATGTGAAGATCCGGTCTGATAGCCGGGATGCAGCGTCTCCGAGCGCCCACCTACCAAGATTTCGAGGACATCGAAAAGGCTTCGGGC
CGCAGACTGGATCGCGCCGAGGTCCATGTCGAACAGGGAGTTCGGATCGAATTCCCCAGTTACCAGATCGACCTCCTGAAGCAGACCCAGCAAAATTTTA
CCGCGCTCAGCCGATCCGGGGGTTAGACACTGGTCCTGTCAGATCTCCGATCTGTTGAACCTGTATGATCGCGAGAACGGGATCCTGAAGCAGGATTtcg
ctcagcaccttccgaTA