Description :
From Genome Similarity Track
Location :
contig_17:145859- 148789
Transcript NameFunction/comments
g4014.t1hypothetical protein PHMEG_0009612
g4015.t1IQ domain-containing protein G

Sequence
2930 bases(100 bases per row)
CGACGAGAGCTCATAGATTGTCGGCTTCTCGTCTTTCGCTACTAAACTAACACGTCGAACTGGGAGTGAGTCGCCCTAACGTCTCCACGTGGCCAGCGAC
TTCTGCAGCTTCTGCTATATTGCTTCAGCTTTGACTGGGAACTTGGTCGGCAGCTCAAGCTCCTTCTTGGTGTGGTGGTGATCACGGCCGTCCGTGTGTC
CATGTCCTCCATAGCTCGAACGAACTCTTTACTCTCCAGCTGCCCGAACGGGAGGCCGTAGCGTCGGTTTCTCCTGGTGGCGTCGTCCGTGGGCGCGTCT
CGTTTCCTGTCGAAGCAGCCCCGGGTCTTAAACGCCAGCAGCAGACCGCAGATCAGGGACACGACGGCGTACAAGCCGCCCGCGATGTAGCAATTGACCT
CCGCAGAGCTGGAACGCACGTGCAGCCCGCGCACGAAGCCCGGCTGGAACCGCAGCAACAAACCGAAGACGGGAATGAGGACCATCCCAGCCAGCGACAG
CGCCATCGCGGCGCGCAAGTAGCTGCTCTCCATGTCGATGTCTCTTCTTGGCAAGAAGTTCGTACTTGAAACCCATGTAACCTCAGGAATGAGATAGGTA
CGTAATACCCCTTTGGGATTGGTAGATAAAAGTGATAACCAATCATATCATCGGATTGAGTAGCCATTTTCCGGTGGGCGCCTTTTGTTGTCTGCTGCCA
ATGCAAGTCAATTTTTGTCCTATGATGCTATTCAGTTGGGTTACCTTTTCCCTGCACAGGCAGTCTACAAACCGCGCCATTCTACCTTTGTGCATCGCTC
TTTCCTCTTCAAGTTCGGCTCTCTCTATGCGCGTGTGCTGGCCGGAGCCTTGTGATCACGGAAGCTCTTGAGCTCGGCAAGTCGCACGAAGCGGTGGTAG
ATCAGCGGGTGCAGCTGACTGAGCCGTCCCGGGTTCTCGGCGAAGCACACGAACAACGTCTTGATGACGGCCGCGATCACTTGCGTGGCCAGCGAGATGG
TCGTGTAGCAGAGCGTGAACGCCGCCAACGTGAAAAACGTCGCGTGCGACGATGCACCAGCAAGCGCCGACGCAGTCAACGCACTCATGATACCTGCCCA
GCCATTGCCACCGAGAAGCAGGATGCGGCTCGTCAAGTCGTCATCCACGATCGCCTCCACGCCGTGATGCTCGATCAGTTTCCACGCGTCCTGCGCCGCC
ACATAATAAGGCTTGTTGTAGCCAGCAACGTGCACGAACGAGTACTTGTGGTACGTGCGGATAAAATACTCCACTCGCTCTGAGCGCAGCGACATAAATC
TCCTTGAAAGCACCGACTCATCTCGTCGTGCCCAGCGCAGAGCGTTCCACACGAGATGAGCCAACGGGCACAGCAGTGAGCCGATGCAAATTGATCCGAA
CGAGCTCGACATCGCGCAGCGTGCGTAGTGCAGCACGACTTTCCTGTCCAGGTAATCGGTGCTTGGATTCTGTTGCACTTGGCCATTGGCCTCATCGCTC
GGGGAGTCGTGGTCTGAGATGTTCTCGCGAATGTCGGGCGAGATCTCAGTCGATTCGTTGCGGTAGTACCAGATCATCGTCGTACCGGAAGCCACGATCG
TCAAAATGTTCTTGAAGACGTTGGACATCCAGTAGAAGTGGAAGACGAGGTAGATTATCGAGAAGTTCCAGGGCGACAGATCGCGGCCAACATAGCCGAT
CGTTGTGCAGATCCAGCTGGCCCAGATCGTGTAGGCCACCAACATAACACACGTGGCACCCCCAGCGCCGGATGGGCTACCAGAAATTCCACGACCAGCT
CAAAGAACACCGCGACGAAGTCCAGGCCGTGGTTGGCGCGTGCGTACCACACGAGGTCCAGCACCACGACACCACTGCAAATGACCCCCCAGAACATACC
CTCGCCCGACTCCAGCAGGAAGAGCATGGCCGCCAGCATCGACAGCCCCGCCATGGAGAATATACACGACCCCTGCACGAAGCGTAGCTTGGAGTAGAAG
ATAAAAAGCAGCAGCCAGCCCAGGGCGAACAGCATGTTCACGACGCAGAGCGAGCGCAGCGCCACGCCTACATCTGCGTCGTCCTGCGCTAGACTCGCGT
CCTGTTGCAGACCGCCCACGACGTCGCTGCGCTCGTCCGCCTGCTCCTCCTGCTCGCCGACCGCGCGGATGCTGCTGGTGGCTACCAGCATCAGAATCAG
GTGCAGCACAAAGAGCCCAGCGAACGGAACGTCGCGATACATGAGCGGAGAGTGCAGCGACGGCAGCGGGCGCTCACCGCTGGCTGAGTCCGTCATGGAC
AGCGGGATGAGCTTGGAGGCGGACGCCAAATCGTAGTCCTCATCGTCCTCGTCGTCGTTCCGGGGCGTGGGGGACAGCGATAGATCCTCCATGGCCGCGA
CGGGGGACGACGGAGCTTCCAGCGGCCGGTCATTCGCGTCGTCGATAGCAATGCTCGACGGCCGCGAGGTGGGCGTCGCCATGGTGTCTCCTTGAGCTGT
TCGGCAGTTGAAAGCGAAAAAGTGGTCGAGGAAATATCGCGGTTAAAAATAGACGAAACCGGTTACAGTCGGTATACTGTCTCGTGCTATCGGTAGGCCA
TGTACGGTAATCGACAGGTCATTACGGTTATCGACTGCTGCTGAACCTCTTCCCGCATTTTCGGGGAAGCTCCGTGCGCCGGACTCCATTAGACTGTTCG
GTGGCGACCCCGCCACTCGTCCGGCCAGTTCAGCGCTTCGCACGGCCAGAAGCGTGTGTCTTGATGCCGGTGCCACGCTGGCACGAGGATATGCTCGAGG
TAGCCATATTACCCCGTCTTTATCGCATGATGTATGCCGTTTGGCAGTAAATCCTATCACACAGCATACGTCATGGTCCGAACCCAGCTGGCGTCGTCTT
CTCGCTGGACATACAAACGGCAAGTGATTT