Description :
From Genome Similarity Track
Location :
Scaffold_155:14584- 16079
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.16Chromosome 03 contig 1, DNA sequence

Sequence
1495 bases(100 bases per row)
ATCCCGCAGCCCGACGGCTGCGTGTACGCGTTCGCACGCGACACGAACGTCATATGGCGCCACGGCATCCTGCAGGATGCGCCCGTGCGCGACGAAGGCC
GCATCTCCGTCATTGCGTGGGGCTGGATCGACGGCATGGTCGACCCAGAAGCGGCCGTCACCAACACGCCTTAAGAAGAAAAGAGCGTGAAGTAGTTCAT
GTGAGAGAGAGACGTATGTGTGTCATGGCGTGCGTACGTTAACGAAGCAATTGGAATAGAACAAAGTGCGACGCGCTTCAAGGTGTCGCCTGGCTTTGGC
ATGAGTAACATCCACGCAACATGGATTTACAGGTCGATGGCGACAAACGTCTTCTTCTTCACACTGCTGCTCGCTACTGCGGTTGCCGTACTGATCGTCG
CGCCATTCAACTCGGCGATGAGCGCGTTGCGCTTCATCTGGAGCTCGTCTTTTCGCGCGAGTTTCTTCTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGACAGCGCCTTGGTTTCCTCGTTGCCCCCATCGTTCGCTCTTGCTGCGGCTTCGAGCTTGGCGATCTCCTTCAGAAGCTTGTTGAGTTTGGTC
AGTTCCTGTTTCAACGCCGCCGTGCTGTCGCCACCGCTTGCCTTGGCGTCATCGCGTACACGAGGAGCTGTTGACNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTCTCGAATTGCTTGGTCGCGGCTTCCGCTCCTGTGCTTTGCTTTCCAGCGACAACGACGCCAGTGACAACTCATCTGAATCCGCCGTA
TCTGCCGCGCTCGTTGCGGTCTGCTGTTGCGGAGCGCCTTGCTTGCCTGCGGCTTCAAGCGCTTCTTGCTCACGTCTCTATCCACGCAGTAAGAAAGCAC
CGCGTTAAAAGCGCAAAGTGAACAGTGCATGTTTCAAGACACCGCAAACGTATTCATGGGACACTCACGCGCTGCGCGACGGTCTTGTACTTGGGCACCT
CGTCCTGCGCGACGTAGCCCTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGCGTTGACGATGCCATCATTTTCCAGATTTGGGATTTTCCTTTGGAGAAAAAAAGGGACTGTAATAGAGG
GCGGGCGGGCCACCCAAAATTGCGGAATTGGATGATAATAATGGAGAAAGCGCAGTGAAGACGCATGGAGAAAGACGGCGCGCGAAGGAAGAACGGAGGA
GCATGAGGAGCAAGAGCTGCGCGTGTGCGCTGCGTGCCGTTGTCACTCGCCTGGTTGCTGCTGCGGCATGGTGCCGTACCGAGTGCCGACGAGTGCGGAG
GCGCCAGTGTGTACGCGATCTTAAGAGTCGAGAGTGTGCCCTTGGTGCTGAAATTGTATTGTGCAGGTGGCGAAGGTGTGTGTTGTCTCGTCGCT