Description :
From Genome Similarity Track
Location :
Scaffold_2094:1458- 2756
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2094-snap-gene-0.1Dicarboxylate/amino acid:cation

Sequence
1298 bases(100 bases per row)
GTCTCGCCGACCTGCTCCGCGACGATGCGGCAGACGACCGTGTCGCACGTGACGTTCACGGCCGTGTGGAAGCGGTCGATGATCCAGTCCGTGGCCACGA
TGAACGCGAACGTGGACGGTAACGGTACGTTCGGGAACACGCTCGCCCACACGGTCATGGTCATCACGATACTGGCGGCGGGCACGGGGCCGGCGCCGAT
CGCGCCGATGGTCGACACGAGGATGATCATGAAGTACTCAACGCCGCCGATGATACTTCCAATCCCTTCGGCCTCGGCCATGAACACGACCGCGACAGGA
TACCCGAGCGCCGCACCATCCATGCCGATGGTCGCGCCGAGCGAGANNNNNNNNNNCGAGAGCGTCTGCGAGATCTCGCGCGTCTCGTCGATGCACTCCA
TGACCACGGGCAGCGTCGCCATGGACGACGCGCACCCGAACGCAAAGAGCTGCGCGCGCAGCATCTTCTTGAGCCACGCGAACGGGTTGCACTTGACGAA
CGCGCGCAACAGCACGGGGTAGAAGATGTACGTGTGCGCGAACAGGCTGAGGATGCAGCAGAGCACATAGAGCCCGACGTCCGTGACGATGCTCTTGAGA
TCCTTCTGCTCCGAGATTGACTTGGCCAGCAGCGAGATGATCGCCACGGGCGTGCACTTGATCACCCACATGATCATCGTCATGAACACCATGTTGATCT
CGCGGAAGAAGTCGCCGACGATCTTCGCGTTGCGCGGCAGCAGCGAGATCGCGACGCCGAACGGAATCGCAAACATGATGATCGACAGCAGCGTGGCCTC
CGAGAATGCGAGCGTGATGTTCGCCGGCACCATGGCGTCGAGCTGGCCCTGCAGCGCCTGGGTCAGCGACCGCTTGGCGTACGATGTGGTGCTCGCCACA
CCAAAGTAGCCGTTCACGTCGGCCGCGGTGAACTCGGAGCTTGGCGAGTAGCTCAGTCCCGCACTGATGTTGAACGTCGCGTCGTAGACACACGACACCG
TGCCGTTTGCAAAGTGACTCAGGTAGAAACCCGGCTGGCCGCACTGGAACGCCATTTTCGCGATCTTGGCGGCCGTTTGCTCGCGGACCTTGTCGCCAAA
GTACGGACGGAACACGAGCACCCAGAGCAGCCCCTCGATGGTCGCGACGACCGTCGTGGTGAGGTAGAGCAGCCCTGTGCGCCAGCCAATCGCTGACGCC
TTGCCGACCGCGAGCATGTCGGCCATGCCGACGATCAGGCTGCAGAACACGAGCGGCGTGACGAGGCACTTAATCGCACGGATGAAGAGGTTGCCGGG